CRNN cdna clone
CRNN cDNA Clone
Gene Names
CRNN; DRC1; PDRC1; SEP53; C1orf10
Synonyms
CRNN; CRNN cDNA Clone; CRNN cdna clone
Sequence
atgcctcagttactgcaaaacattaatgggatcatcgaggccttcaggcgctatgcaaggacggagggcaactgcacagcgctcacccgaggggagctgaaaagactcttggagcaagagtttgccgatgtgattgtgaaaccccacgatccagcaactgtggatgaggtcctgcgtctgctggatgaagaccacacagggactgtggaattcaaggaattcctggtcttagtgtttaaagttgcccaggcctgtttcaagacactgagcgagagtgctgagggagcctgcggctctcaagagtctggaagcctccactctggggcctcgcaggagctgggcgaaggacagagaagtggcactgaagtgggaagggcggggaaagggcagcattatgaggggagcagccacagacagagccagcagggttccagagggcagaacaggcctggggttcagacccagggtcaggccactggctctgcgtgggtcagcagctatgacaggcaagctgagtcccagagccaggaaagaataagcccgcagatacaactctctgggcagacagagcagacccagaaagctggagaaggcaagaggaatcagacaacagagatgaggccagagagacagccacagaccagggaacaggacagagcccaccagacaggtgagactgtgactggatctggaactcagacccaggcaggtgccacccagactgtggagcaggacagcagccaccagacaggaagaaccagcaagcagacacaggaggccaccaatgaccagaacagagggactgagacccacggtcaaggcaggagccagaccagccaggctgtgacaggaggacatgctcagatacaggcagggacacacacccagacacccacccagaccgtggagcaggacagcagccaccagacaggaagcaccagcacccagacacaggagtccaccaatggccagaacagagggactgagatccacggtcaaggcaggagccagaccagccaggctgtgacaggaggacacactcagatacaggcagggtcacacaccgagactgtggagcaggacagaagccaaactgtaagccacggaggggctagagaacagggacagacccagacgcagccaggcagtggtcaaagatggatgcaagtgagcaaccctgaggcaggagagacagtaccgggaggacaggcccagactggggcaagcactgagccaggaaggcaggagtggagcagcactcacccaaggcgctgtgtgacagaagggcagggagacagacagcccacagtggttggtgaggaatgggttgatgaccactcaagggagacagtgatcctcaggctggaccagggcaacttgcataccagtgtttcctcagcacagggccaggatgcagcccagtcagaagagaagcgaggcatcacagctagagagctgtattcctacttgagaagcaccaagccatga
Sequence Length
1488
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
53,533 Da
NCBI Official Full Name
Homo sapiens cornulin, mRNA
NCBI Official Synonym Full Names
cornulin
NCBI Official Symbol
CRNN
NCBI Official Synonym Symbols
DRC1; PDRC1; SEP53; C1orf10
NCBI Protein Information
cornulin
UniProt Protein Name
Cornulin
Protein Family
UniProt Gene Name
CRNN
UniProt Synonym Gene Names
C1orf10; DRC1; PDRC1; SEP53
UniProt Entry Name
CRNN_HUMAN
NCBI Description
This gene encodes a member of the "fused gene" family of proteins, which contain N-terminus EF-hand domains and multiple tandem peptide repeats. The encoded protein contains two EF-hand Ca2+ binding domains in its N-terminus and two glutamine- and threonine-rich 60 amino acid repeats in its C-terminus. This gene, also known as squamous epithelial heat shock protein 53, may play a role in the mucosal/epithelial immune response and epidermal differentiation. [provided by RefSeq, Jan 2009]
Uniprot Description
CRNN: Survival factor that participates in the clonogenicity of squamous esophageal epithelium cell lines, attenuates deoxycholic acid (DCA)-induced apoptotic cell death and release of calcium. When overexpressed in oral squamous carcinom cell lines, regulates negatively cell proliferation by the induction of G1 arrest. Belongs to the S100-fused protein family.
Chromosomal Location of Human Ortholog: 1q21
Cellular Component: cytoplasm; membrane
Biological Process: cell-cell adhesion; response to heat
Research Articles on CRNN
Similar Products
Product Notes
The CRNN crnn (Catalog #AAA1269762) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctcagt tactgcaaaa cattaatggg atcatcgagg ccttcaggcg ctatgcaagg acggagggca actgcacagc gctcacccga ggggagctga aaagactctt ggagcaagag tttgccgatg tgattgtgaa accccacgat ccagcaactg tggatgaggt cctgcgtctg ctggatgaag accacacagg gactgtggaa ttcaaggaat tcctggtctt agtgtttaaa gttgcccagg cctgtttcaa gacactgagc gagagtgctg agggagcctg cggctctcaa gagtctggaa gcctccactc tggggcctcg caggagctgg gcgaaggaca gagaagtggc actgaagtgg gaagggcggg gaaagggcag cattatgagg ggagcagcca cagacagagc cagcagggtt ccagagggca gaacaggcct ggggttcaga cccagggtca ggccactggc tctgcgtggg tcagcagcta tgacaggcaa gctgagtccc agagccagga aagaataagc ccgcagatac aactctctgg gcagacagag cagacccaga aagctggaga aggcaagagg aatcagacaa cagagatgag gccagagaga cagccacaga ccagggaaca ggacagagcc caccagacag gtgagactgt gactggatct ggaactcaga cccaggcagg tgccacccag actgtggagc aggacagcag ccaccagaca ggaagaacca gcaagcagac acaggaggcc accaatgacc agaacagagg gactgagacc cacggtcaag gcaggagcca gaccagccag gctgtgacag gaggacatgc tcagatacag gcagggacac acacccagac acccacccag accgtggagc aggacagcag ccaccagaca ggaagcacca gcacccagac acaggagtcc accaatggcc agaacagagg gactgagatc cacggtcaag gcaggagcca gaccagccag gctgtgacag gaggacacac tcagatacag gcagggtcac acaccgagac tgtggagcag gacagaagcc aaactgtaag ccacggaggg gctagagaac agggacagac ccagacgcag ccaggcagtg gtcaaagatg gatgcaagtg agcaaccctg aggcaggaga gacagtaccg ggaggacagg cccagactgg ggcaagcact gagccaggaa ggcaggagtg gagcagcact cacccaaggc gctgtgtgac agaagggcag ggagacagac agcccacagt ggttggtgag gaatgggttg atgaccactc aagggagaca gtgatcctca ggctggacca gggcaacttg cataccagtg tttcctcagc acagggccag gatgcagccc agtcagaaga gaagcgaggc atcacagcta gagagctgta ttcctacttg agaagcacca agccatga. It is sometimes possible for the material contained within the vial of "CRNN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
