Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CRISPLD1 cdna clone

CRISPLD1 cDNA Clone

Gene Names
CRISPLD1; CRISP10; LCRISP1; CRISP-10
Synonyms
CRISPLD1; CRISPLD1 cDNA Clone; CRISPLD1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagtgtaccgcgcgggagtggctcagagtaaccacagtgctgttcatggctagagcaattccagccatggtggttcccaatgccactttattggagaaacttttggaaaaatacatggatgaggatggtgagtggtggatagccaaacaacgagggaaaagggccatcacagacaatgacatgcagagtattttggaccttcataataaattacgaagtcaggtgtatccaacagcctctaatatggagtatatgacatgggatgtagagctggaaagatctgcagaatcctgggctgaaagttgcttgtgggaacatggacctgcaagcttgcttccatcaattggacagaatttgggagcacactggggaagatataggcccccgacgtttcatgtacaatcgtggtatgatgaagtgaaagactttagctacccatatgaacatgaatgcaacccatattgtccattcaggtgttctggccctgtatgtacacattatacacaggtcgtgtgggcaactagtaacagaatcggttgtgccattaatttgtgtcataacatgaacatctgggggcagatatggcccaaagctgtctacctggtgtgcaattactccccaaagggaaactggtggggccatgccccttacaaacatgggcggccctgttctgcttgcccacctagttttggagggggctgtagagaaaatctgtgctacaaagaagggtcagacaggtattatccccctcgagaagaggaaacaaatgaaatagaacgacagcagtcacaagtccatgacacccatgtccggacaagatcagatgatagtagcagaaatgaagtcataagcgcacagcaaatgtcccaaattgtttcttgtgaagtaagattaagagatcagtgcaaaggaacaacctgcaataggtacgaatgtcctgctggctgtttggatagtaaagctaaagttattggcagtgtacattatgaaatgcaatccagcatctgtagagctgcaattcattatggtataatagacaatgatggtggctgggtagatatcactagacaaggaagaaagcattatttcatcaagtccaatagaaatggtattcaaacaattggcaaatatcagtctgctaattccttcacagtctctaaagtaacagttcaggctgtgacttgtgaaacaactgtggaacagctctgtccatttcataagcctgcttcacattgcccaagagtatactgtcctcgtaactgtatgcaagcaaatccacattatgctcgtgtaattggaactcgagtttattctgatctgtccagtatctgcagagcagcagtacatgctggagtggttcgaaatcacggtggttatgttgatgtaatgcctgtggacaaaagaaagacctacattgcttcttttcagaatggaatcttctcagaaagtttacagaatcctccaggaggaaaggcattcagagtgtttgctgttgtgtga
Sequence Length
1503
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,172 Da
NCBI Official Full Name
Homo sapiens cysteine-rich secretory protein LCCL domain containing 1, mRNA
NCBI Official Synonym Full Names
cysteine rich secretory protein LCCL domain containing 1
NCBI Official Symbol
CRISPLD1
NCBI Official Synonym Symbols
CRISP10; LCRISP1; CRISP-10
NCBI Protein Information
cysteine-rich secretory protein LCCL domain-containing 1
UniProt Protein Name
Cysteine-rich secretory protein LCCL domain-containing 1
UniProt Gene Name
CRISPLD1
UniProt Synonym Gene Names
CRISP10; LCRISP1; CRISP-10
UniProt Entry Name
CRLD1_HUMAN

Uniprot Description

CRISPLD1: Belongs to the CRISP family.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 8q21.11

Research Articles on CRISPLD1

Similar Products

Product Notes

The CRISPLD1 crispld1 (Catalog #AAA1270464) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagtgta ccgcgcggga gtggctcaga gtaaccacag tgctgttcat ggctagagca attccagcca tggtggttcc caatgccact ttattggaga aacttttgga aaaatacatg gatgaggatg gtgagtggtg gatagccaaa caacgaggga aaagggccat cacagacaat gacatgcaga gtattttgga ccttcataat aaattacgaa gtcaggtgta tccaacagcc tctaatatgg agtatatgac atgggatgta gagctggaaa gatctgcaga atcctgggct gaaagttgct tgtgggaaca tggacctgca agcttgcttc catcaattgg acagaatttg ggagcacact ggggaagata taggcccccg acgtttcatg tacaatcgtg gtatgatgaa gtgaaagact ttagctaccc atatgaacat gaatgcaacc catattgtcc attcaggtgt tctggccctg tatgtacaca ttatacacag gtcgtgtggg caactagtaa cagaatcggt tgtgccatta atttgtgtca taacatgaac atctgggggc agatatggcc caaagctgtc tacctggtgt gcaattactc cccaaaggga aactggtggg gccatgcccc ttacaaacat gggcggccct gttctgcttg cccacctagt tttggagggg gctgtagaga aaatctgtgc tacaaagaag ggtcagacag gtattatccc cctcgagaag aggaaacaaa tgaaatagaa cgacagcagt cacaagtcca tgacacccat gtccggacaa gatcagatga tagtagcaga aatgaagtca taagcgcaca gcaaatgtcc caaattgttt cttgtgaagt aagattaaga gatcagtgca aaggaacaac ctgcaatagg tacgaatgtc ctgctggctg tttggatagt aaagctaaag ttattggcag tgtacattat gaaatgcaat ccagcatctg tagagctgca attcattatg gtataataga caatgatggt ggctgggtag atatcactag acaaggaaga aagcattatt tcatcaagtc caatagaaat ggtattcaaa caattggcaa atatcagtct gctaattcct tcacagtctc taaagtaaca gttcaggctg tgacttgtga aacaactgtg gaacagctct gtccatttca taagcctgct tcacattgcc caagagtata ctgtcctcgt aactgtatgc aagcaaatcc acattatgct cgtgtaattg gaactcgagt ttattctgat ctgtccagta tctgcagagc agcagtacat gctggagtgg ttcgaaatca cggtggttat gttgatgtaa tgcctgtgga caaaagaaag acctacattg cttcttttca gaatggaatc ttctcagaaa gtttacagaa tcctccagga ggaaaggcat tcagagtgtt tgctgttgtg tga. It is sometimes possible for the material contained within the vial of "CRISPLD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.