CPT1A cdna clone
CPT1A cDNA Clone
Gene Names
CPT1A; CPT1; CPT1-L; L-CPT1
Synonyms
CPT1A; CPT1A cDNA Clone; CPT1A cdna clone
Sequence
atggcagaagctcaccaagctgtggcctttcagttcacggtcactccggacgggattgacctgcggctgagccatgaagctcttagacaaatctatctctctggacttcattcctggaaaaagaagttcatcagattcaagaacggcatcatcactggcgtgtacccggcaagcccctccagttggcttatcgtggtggtgggcgtgatgacaacgatgtacgccaagatcgacccctcgttaggaataattgcaaaaatcaatcggactctggaaacggccaactgcatgtccagccagacgaagaacgtggtcagcggcgtgctgtttggcaccggcctgtgggtggccctcatcgtcaccatgcgctactccctgaaagtgctgctctcctaccacgggtggatgttcactgagcacggcaagatgagtcgtgccaccaagatctggatgggtatggtcaagatcttttcaggccgaaaacccatgttgtacagcttccagacatcgctgcctcgcctgccggtcccggctgtcaaagacactgtgaacaggtatctacagtcggtgaggcctcttatgaaggaagaagacttcaaacggatgacagcacttgctcaagattttgctgtcggtcttggaccaagattacagtggtatttgaagttaaaatcctggtgggctacaaattacgtgagcgactggtgggaggagtacatctacctccgaggacgagggccgctcatggtgaacagcaactattatgccatggatctgctgtatatccttccaactcacattcaggcagcaagagccggcaacgccatccatgccatcctgctttacaggcgcaaactggaccgggaggaaatcaaaccaattcgtcttttgggatccacgattccactctgctccgctcagtgggagcggatgtttaatacttcccggatcccaggagaggagacagacaccatccagcacatgagagacagcaagcacatcgtcgtgtaccatcgaggacgctacttcaaggtctggctctaccatgatgggcggctgctgaagccccgggagatggagcagcagatgcagaggatcctggacaatacctcggagcctcagcccggggaggccaggctggcagccctcaccgcaggagacagagttccctgggccaggtgtcgtcaggcctattttggacgtgggaaaaataagcagtctcttgatgctgtggagaaagcagcgttcttcgtgacgttagatgaaactgaagaaggatacagaagtgaagacccggatacgtcaatggacagctacgccaaatctctactacacggccgatgttacgacaggtggtttgacaagtcgttcacgtttgttgtcttcaaaaacgggaagatgggcctcaacgctgaacactcctgggcagatgcgccgatcgtggcccacctttgggagtacgtcatgtccattgacagcctccagctgggctatgcggaggatgggcactgcaaaggcgacatcaatccgaacattccgtaccccaccaggctgcagtgggacatcccgggggaatgtcaagaggttatagagacctccctgaacaccgcaaatcttctggcaaacgacgtggatttccattccttcccattcgtagcctttggtaaaggaatcatcaagaaatgtcgcacgagcccagacgcctttgtgcagctggccctccagctggcgcactacaaggacatgggcaagttttgcctcacatacgaggcctccatgacccggctcttccgagaggggaggacggagaccgtgcgctcctgcaccactgagtcatgcgacttcgtgcgggccatggtggacccggcccagacggtggaacagaggctgaagttgttcaagttggcgtctgagaagcatcagcatatgtatcgcctcgccatgaccggctctgggatcgatcgtcacctcttctgcctttacgtggtgtctaaatatctcgctgtggagtcccctttccttaaggaagttttatctgagccttggagattatcaacaagccagacccctcagcagcaagtggagctgtttgacttggagaataacccagagtacgtgtccagcggagggggctttggaccggttgctgatgacggctatggtgtgtcgtacatccttgtgggagagaacctcatcaatttccacatttcttccaagttctcttgccctgagacggggattataagtcaaggaccaagttcagatacttga
Sequence Length
2271
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
86,239 Da
NCBI Official Full Name
Homo sapiens carnitine palmitoyltransferase 1A (liver), mRNA
NCBI Official Synonym Full Names
carnitine palmitoyltransferase 1A
NCBI Official Symbol
CPT1A
NCBI Official Synonym Symbols
CPT1; CPT1-L; L-CPT1
NCBI Protein Information
carnitine O-palmitoyltransferase 1, liver isoform
UniProt Protein Name
Carnitine O-palmitoyltransferase 1, liver isoform
Protein Family
UniProt Gene Name
CPT1A
UniProt Synonym Gene Names
CPT1; CPT1-L; CPT I; CPTI-L
UniProt Entry Name
CPT1A_HUMAN
NCBI Description
The mitochondrial oxidation of long-chain fatty acids is initiated by the sequential action of carnitine palmitoyltransferase I (which is located in the outer membrane and is detergent-labile) and carnitine palmitoyltransferase II (which is located in the inner membrane and is detergent-stable), together with a carnitine-acylcarnitine translocase. CPT I is the key enzyme in the carnitine-dependent transport across the mitochondrial inner membrane and its deficiency results in a decreased rate of fatty acid beta-oxidation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Uniprot Description
CPT1A: Belongs to the carnitine/choline acetyltransferase family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Transferase; Membrane protein, integral; Lipid Metabolism - fatty acid; EC 2.3.1.21; Mitochondrial; Membrane protein, multi-pass
Chromosomal Location of Human Ortholog: 11q13.2
Cellular Component: integral to mitochondrial outer membrane; membrane; mitochondrial outer membrane; mitochondrion
Molecular Function: carnitine O-palmitoyltransferase activity
Biological Process: carnitine metabolic process; carnitine shuttle; circadian rhythm; epithelial cell differentiation; long-chain fatty acid metabolic process
Disease: Carnitine Palmitoyltransferase I Deficiency
Research Articles on CPT1A
Similar Products
Product Notes
The CPT1A cpt1a (Catalog #AAA1277321) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagaag ctcaccaagc tgtggccttt cagttcacgg tcactccgga cgggattgac ctgcggctga gccatgaagc tcttagacaa atctatctct ctggacttca ttcctggaaa aagaagttca tcagattcaa gaacggcatc atcactggcg tgtacccggc aagcccctcc agttggctta tcgtggtggt gggcgtgatg acaacgatgt acgccaagat cgacccctcg ttaggaataa ttgcaaaaat caatcggact ctggaaacgg ccaactgcat gtccagccag acgaagaacg tggtcagcgg cgtgctgttt ggcaccggcc tgtgggtggc cctcatcgtc accatgcgct actccctgaa agtgctgctc tcctaccacg ggtggatgtt cactgagcac ggcaagatga gtcgtgccac caagatctgg atgggtatgg tcaagatctt ttcaggccga aaacccatgt tgtacagctt ccagacatcg ctgcctcgcc tgccggtccc ggctgtcaaa gacactgtga acaggtatct acagtcggtg aggcctctta tgaaggaaga agacttcaaa cggatgacag cacttgctca agattttgct gtcggtcttg gaccaagatt acagtggtat ttgaagttaa aatcctggtg ggctacaaat tacgtgagcg actggtggga ggagtacatc tacctccgag gacgagggcc gctcatggtg aacagcaact attatgccat ggatctgctg tatatccttc caactcacat tcaggcagca agagccggca acgccatcca tgccatcctg ctttacaggc gcaaactgga ccgggaggaa atcaaaccaa ttcgtctttt gggatccacg attccactct gctccgctca gtgggagcgg atgtttaata cttcccggat cccaggagag gagacagaca ccatccagca catgagagac agcaagcaca tcgtcgtgta ccatcgagga cgctacttca aggtctggct ctaccatgat gggcggctgc tgaagccccg ggagatggag cagcagatgc agaggatcct ggacaatacc tcggagcctc agcccgggga ggccaggctg gcagccctca ccgcaggaga cagagttccc tgggccaggt gtcgtcaggc ctattttgga cgtgggaaaa ataagcagtc tcttgatgct gtggagaaag cagcgttctt cgtgacgtta gatgaaactg aagaaggata cagaagtgaa gacccggata cgtcaatgga cagctacgcc aaatctctac tacacggccg atgttacgac aggtggtttg acaagtcgtt cacgtttgtt gtcttcaaaa acgggaagat gggcctcaac gctgaacact cctgggcaga tgcgccgatc gtggcccacc tttgggagta cgtcatgtcc attgacagcc tccagctggg ctatgcggag gatgggcact gcaaaggcga catcaatccg aacattccgt accccaccag gctgcagtgg gacatcccgg gggaatgtca agaggttata gagacctccc tgaacaccgc aaatcttctg gcaaacgacg tggatttcca ttccttccca ttcgtagcct ttggtaaagg aatcatcaag aaatgtcgca cgagcccaga cgcctttgtg cagctggccc tccagctggc gcactacaag gacatgggca agttttgcct cacatacgag gcctccatga cccggctctt ccgagagggg aggacggaga ccgtgcgctc ctgcaccact gagtcatgcg acttcgtgcg ggccatggtg gacccggccc agacggtgga acagaggctg aagttgttca agttggcgtc tgagaagcat cagcatatgt atcgcctcgc catgaccggc tctgggatcg atcgtcacct cttctgcctt tacgtggtgt ctaaatatct cgctgtggag tcccctttcc ttaaggaagt tttatctgag ccttggagat tatcaacaag ccagacccct cagcagcaag tggagctgtt tgacttggag aataacccag agtacgtgtc cagcggaggg ggctttggac cggttgctga tgacggctat ggtgtgtcgt acatccttgt gggagagaac ctcatcaatt tccacatttc ttccaagttc tcttgccctg agacggggat tataagtcaa ggaccaagtt cagatacttg a. It is sometimes possible for the material contained within the vial of "CPT1A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
