Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CPSF6 cdna clone

CPSF6 cDNA Clone

Gene Names
CPSF6; CFIM; CFIM68; HPBRII-4; HPBRII-7
Synonyms
CPSF6; CPSF6 cDNA Clone; CPSF6 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggacggcgtggaccacatagacatttacgcggatgtcggcgaagagttcaaccaggaagctgaatatggtgggcatgatcagatagatttgtatgacgatgtcatatctccatctgcaaataatggagatgccccagaagaccgagattacatggatactctcccaccaactgttggtgatgatgtgggtaaaggagcagcaccaaatgttgtctatacatatactggaaagagaattgcattatatattggaaatctaacatggtggacaacagatgaagacttaactgaagcagttcattctttgggagtaaatgatattttggagataaaattttttgaaaatcgagcaaatggccagtcaaaggggtttgcccttgttggtgttggatctgaagcatcttcaaaaaagttaatggatctgttacctaaaagagaacttcatggtcagaatcctgttgtaactccatgcaataaacagttcctgagtcaatttgaaatgcagtccaggaaaactacacaatcaggacaaatgtctggggaaggtaaagctggtcctcctctagctgggcctcctaatcgaggagatcgccctccaccaccagttctttttcctggacaaccttttgggcagcctccattgggtccacttcctcctggccctccacctccagttccaggctacggcccccctcctggcccaccacctccacaacagggaccacctccacctccaggcccctttccacctcgtccacccggtccacttgggccaccccttacactagctcctcctccgcatcttcctggaccacctccaggtgccccaccgccagctccgcatgtgaacccagctttctttcctccaccaactaacagtggcatgcctacatcagatagccgaggtccaccaccaacagatccatatgggcgacctccaccatatgataggggtgactatggcccccctggaagggaaatggatactgcaagaacgccattgagtgaagctgaatttgaagaaatcatgaatagaaatagggcaatctcaagcagtgctatttcgagagctgtgtctgatgccagtgctggtgattatgggagtgctattgagacactggtaactgcaatttctttaattaaacaatccaaagtatctgctgatgatcgttgcaaagttcttattagttctttgcaagattgccttcatggaattgagtccaagtcttatggttctggatcaagacgtgaacgatcaagagagagggaccatagtagatcacgagaaaagagtcgacgtcataaatcccgtagtagagaccgtcatgacgattattacagagagagaagcagagaacgagagaggcaccgggatcgtgaccgagaccgtgaccgagagcgtgaccgagagcgcgaatatcgtcatcgttag
Sequence Length
1437
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,326 Da
NCBI Official Full Name
Homo sapiens cleavage and polyadenylation specific factor 6, 68kDa, mRNA
NCBI Official Synonym Full Names
cleavage and polyadenylation specific factor 6
NCBI Official Symbol
CPSF6
NCBI Official Synonym Symbols
CFIM; CFIM68; HPBRII-4; HPBRII-7
NCBI Protein Information
cleavage and polyadenylation specificity factor subunit 6
UniProt Protein Name
Cleavage and polyadenylation specificity factor subunit 6
UniProt Gene Name
CPSF6
UniProt Synonym Gene Names
CFIM68; CFIm68; CPSF 68 kDa subunit
UniProt Entry Name
CPSF6_HUMAN

NCBI Description

The protein encoded by this gene is one subunit of a cleavage factor required for 3' RNA cleavage and polyadenylation processing. The interaction of the protein with the RNA is one of the earliest steps in the assembly of the 3' end processing complex and facilitates the recruitment of other processing factors. The cleavage factor complex is composed of four polypeptides. This gene encodes the 68kD subunit. It has a domain organization reminiscent of spliceosomal proteins. [provided by RefSeq, Jul 2008]

Uniprot Description

CPSF6: Component of the cleavage factor Im complex (CFIm) that plays a key role in pre-mRNA 3'-processing. Involved in association with NUDT21/CPSF5 in pre-MRNA 3'-end poly(A) site cleavage and poly(A) addition. CPSF6 binds to cleavage and polyadenylation RNA substrates and promotes RNA looping. Belongs to the RRM CPSF6/7 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: RNA-binding; Spliceosome; RNA processing

Chromosomal Location of Human Ortholog: 12q15

Cellular Component: membrane; mRNA cleavage factor complex; nucleoplasm; nucleus; paraspeckles; ribonucleoprotein complex

Molecular Function: mRNA binding; protein binding; RNA binding

Biological Process: mRNA polyadenylation; mRNA processing; protein tetramerization

Research Articles on CPSF6

Similar Products

Product Notes

The CPSF6 cpsf6 (Catalog #AAA1276795) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggacg gcgtggacca catagacatt tacgcggatg tcggcgaaga gttcaaccag gaagctgaat atggtgggca tgatcagata gatttgtatg acgatgtcat atctccatct gcaaataatg gagatgcccc agaagaccga gattacatgg atactctccc accaactgtt ggtgatgatg tgggtaaagg agcagcacca aatgttgtct atacatatac tggaaagaga attgcattat atattggaaa tctaacatgg tggacaacag atgaagactt aactgaagca gttcattctt tgggagtaaa tgatattttg gagataaaat tttttgaaaa tcgagcaaat ggccagtcaa aggggtttgc ccttgttggt gttggatctg aagcatcttc aaaaaagtta atggatctgt tacctaaaag agaacttcat ggtcagaatc ctgttgtaac tccatgcaat aaacagttcc tgagtcaatt tgaaatgcag tccaggaaaa ctacacaatc aggacaaatg tctggggaag gtaaagctgg tcctcctcta gctgggcctc ctaatcgagg agatcgccct ccaccaccag ttctttttcc tggacaacct tttgggcagc ctccattggg tccacttcct cctggccctc cacctccagt tccaggctac ggcccccctc ctggcccacc acctccacaa cagggaccac ctccacctcc aggccccttt ccacctcgtc cacccggtcc acttgggcca ccccttacac tagctcctcc tccgcatctt cctggaccac ctccaggtgc cccaccgcca gctccgcatg tgaacccagc tttctttcct ccaccaacta acagtggcat gcctacatca gatagccgag gtccaccacc aacagatcca tatgggcgac ctccaccata tgataggggt gactatggcc cccctggaag ggaaatggat actgcaagaa cgccattgag tgaagctgaa tttgaagaaa tcatgaatag aaatagggca atctcaagca gtgctatttc gagagctgtg tctgatgcca gtgctggtga ttatgggagt gctattgaga cactggtaac tgcaatttct ttaattaaac aatccaaagt atctgctgat gatcgttgca aagttcttat tagttctttg caagattgcc ttcatggaat tgagtccaag tcttatggtt ctggatcaag acgtgaacga tcaagagaga gggaccatag tagatcacga gaaaagagtc gacgtcataa atcccgtagt agagaccgtc atgacgatta ttacagagag agaagcagag aacgagagag gcaccgggat cgtgaccgag accgtgaccg agagcgtgac cgagagcgcg aatatcgtca tcgttag. It is sometimes possible for the material contained within the vial of "CPSF6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.