Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

COX10 cdna clone

COX10 cDNA Clone

Synonyms
COX10; COX10 cDNA Clone; COX10 cdna clone
Ordering
For Research Use Only!
Sequence
atggccgcatctccgcacactctctcctcacgcctcctgacaggttgcgtaggaggctctgtctggtatcttgaaagaagaactatacaggactcccctcacaagttcttacatcttctcaggaatgtcaataagcagtggattacatttcagcactttagcttcctcaaacgcatgtatgtcacacagctgaacagaagccacaaccagcaagtaagacccaagccagaaccagtagcatctcctttccttgaaaaaacatcttcaggtcaagccaaagcagaaatatatgagatgagacctctctcaccgcccagcctatctttgtccagaaagccaaatgaaaaggaattgatagaactagagccagactcagtaattgaagactcaatagatgtagggaaagagacaaaagaggaaaagcggtggaaagagatgaagctgcaagtgtatgatttgccaggaattttggctcaactatccaaaatcaaactcacagctctagttgtaagtaccactgcagctggatttgcattggctccgggcccttttgactggccctgtttcctgcttacttctgttgggacaggccttgcatcctgtgctgccaactccatcaatcagttttttgaggtgccatttgactcaaacatgaataggacaaagaacagaccgctggttcgtggacagatcagcccgttgctagctgtgtcctttgccacttgttgtgctgttccgggagttgccattctgaccttgggggtgaatccactcacaggagccctggggctcttcaacattttcctgtatacctgctgctacacaccactgaaaaggatcagcattgccaacacatgggtcggagctgtggttggggccatcccgcctgtcatgggctggacagcggccacgggcagcctcgatgctggcgcatttctcctgggaggaatcctctactcctggcagtttcctcatttcaacgccctgagctggggcctccgtgaagactactcccggggcggctactgcatgatgtcggtcacccacccgggcctgtgccggcgcgtggcgctgcgccactgcctggccctgctcgtgctgtccgcagcagcccctgtgctggacatcaccacatggaccttccccatcatggcccttcccatcaatgcgtacatctcctacctcggcttccgcttctacgtggacgcagaccgcaggagctcgcggagactgttcttctgcagcctgtggcacctgccgctgctgctgctgctcatgctcacctgcaagcggccgagcggaggcggggacgcagggccccctcccagctga
Sequence Length
1332
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,594 Da
NCBI Official Full Name
Homo sapiens COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast), mRNA
NCBI Official Synonym Full Names
COX10, heme A:farnesyltransferase cytochrome c oxidase assembly factor
NCBI Official Symbol
COX10
NCBI Protein Information
protoheme IX farnesyltransferase, mitochondrial
UniProt Protein Name
Protoheme IX farnesyltransferase, mitochondrial
UniProt Gene Name
COX10
UniProt Entry Name
COX10_HUMAN

NCBI Description

Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes heme A:farnesyltransferase, which is not a structural subunit but required for the expression of functional COX and functions in the maturation of the heme A prosthetic group of COX. This protein is predicted to contain 7-9 transmembrane domains localized in the mitochondrial inner membrane. A gene mutation, which results in the substitution of a lysine for an asparagine (N204K), is identified to be responsible for cytochrome c oxidase deficiency. In addition, this gene is disrupted in patients with CMT1A (Charcot-Marie-Tooth type 1A) duplication and with HNPP (hereditary neuropathy with liability to pressure palsies) deletion. [provided by RefSeq, Jul 2008]

Uniprot Description

COX10: Converts protoheme IX and farnesyl diphosphate to heme O. Defects in COX10 are a cause of mitochondrial complex IV deficiency (MT-C4D); also known as cytochrome c oxidase deficiency. A disorder of the mitochondrial respiratory chain with heterogeneous clinical manifestations, ranging from isolated myopathy to severe multisystem disease affecting several tissues and organs. Features include hypertrophic cardiomyopathy, hepatomegaly and liver dysfunction, hypotonia, muscle weakness, excercise intolerance, developmental delay, delayed motor development and mental retardation. A subset of patients manifest Leigh syndrome. Defects in COX10 are a cause of Leigh syndrome (LS). LS is a severe neurological disorder characterized by bilaterally symmetrical necrotic lesions in subcortical brain regions. Belongs to the UbiA prenyltransferase family.

Protein type: Membrane protein, integral; Transferase; Membrane protein, multi-pass; EC 2.5.1.-; Cofactor and Vitamin Metabolism - porphyrin and chlorophyll; Energy Metabolism - oxidative phosphorylation

Chromosomal Location of Human Ortholog: 17p12

Cellular Component: mitochondrial inner membrane; mitochondrion

Molecular Function: cytochrome-c oxidase activity; farnesyltranstransferase activity; protoheme IX farnesyltransferase activity

Biological Process: cellular respiration; heme a biosynthetic process; heme biosynthetic process; mitochondrial electron transport, cytochrome c to oxygen; respiratory chain complex IV assembly

Disease: Leigh Syndrome; Mitochondrial Complex Iv Deficiency

Research Articles on COX10

Similar Products

Product Notes

The COX10 cox10 (Catalog #AAA1272687) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgcat ctccgcacac tctctcctca cgcctcctga caggttgcgt aggaggctct gtctggtatc ttgaaagaag aactatacag gactcccctc acaagttctt acatcttctc aggaatgtca ataagcagtg gattacattt cagcacttta gcttcctcaa acgcatgtat gtcacacagc tgaacagaag ccacaaccag caagtaagac ccaagccaga accagtagca tctcctttcc ttgaaaaaac atcttcaggt caagccaaag cagaaatata tgagatgaga cctctctcac cgcccagcct atctttgtcc agaaagccaa atgaaaagga attgatagaa ctagagccag actcagtaat tgaagactca atagatgtag ggaaagagac aaaagaggaa aagcggtgga aagagatgaa gctgcaagtg tatgatttgc caggaatttt ggctcaacta tccaaaatca aactcacagc tctagttgta agtaccactg cagctggatt tgcattggct ccgggccctt ttgactggcc ctgtttcctg cttacttctg ttgggacagg ccttgcatcc tgtgctgcca actccatcaa tcagtttttt gaggtgccat ttgactcaaa catgaatagg acaaagaaca gaccgctggt tcgtggacag atcagcccgt tgctagctgt gtcctttgcc acttgttgtg ctgttccggg agttgccatt ctgaccttgg gggtgaatcc actcacagga gccctggggc tcttcaacat tttcctgtat acctgctgct acacaccact gaaaaggatc agcattgcca acacatgggt cggagctgtg gttggggcca tcccgcctgt catgggctgg acagcggcca cgggcagcct cgatgctggc gcatttctcc tgggaggaat cctctactcc tggcagtttc ctcatttcaa cgccctgagc tggggcctcc gtgaagacta ctcccggggc ggctactgca tgatgtcggt cacccacccg ggcctgtgcc ggcgcgtggc gctgcgccac tgcctggccc tgctcgtgct gtccgcagca gcccctgtgc tggacatcac cacatggacc ttccccatca tggcccttcc catcaatgcg tacatctcct acctcggctt ccgcttctac gtggacgcag accgcaggag ctcgcggaga ctgttcttct gcagcctgtg gcacctgccg ctgctgctgc tgctcatgct cacctgcaag cggccgagcg gaggcgggga cgcagggccc cctcccagct ga. It is sometimes possible for the material contained within the vial of "COX10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.