Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

COQ6 cdna clone

COQ6 cDNA Clone

Gene Names
COQ6; CGI10; CGI-10; COQ10D6
Synonyms
COQ6; COQ6 cDNA Clone; COQ6 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcccggcttgtcagccgatgcggggctgtgcgtgcagctccccacagcggcccgctggtgtcctggcgcaggtggtccggcgcctcaacagacaccgtgtatgacgtggtggtgtcgggtggaggcctggtgggcgctgccatggcctgtgccttgggatatgatattcactttcatgacaagaaaatcctgttgctcgaagcaggtccaaagaaagtactggagaaattgtcagaaacttacagcaacagggtcagctccatttcccctggctctgcaacgcttctcagtagttttggtgcctgggaccatatctgcaacatgagatacagagcctttcggcgaatgcaggtgtgggacgcctgctcagaggccctgataatgtttgataaggataatttagatgacatgggctatatcgtggagaatgatgtcatcatgcatgctctcactaagcagttggaggctgtgtctgaccgagtgacggttctctacaggagcaaagccattcgctatacctggccttgtccatttcctatggccgactccagcccttgggttcatattaccctaggtgatggcagcaccttccagaccaaattgttgataggtgcagatggtcacaactccggagtacggcaggctgttggaatccagaatgtgagctggaactatgaccagtctgctgttgtggctactctgcatttatcagaggccacagaaaacaacgtagcctggcagagatttcttccctctgggcctattgctctgctcccgctctcagacaccttgagttccttggtttggtccacgtcccatgaacatgcagcagagctagttagcatggatgagaaaaaatttgtggatgccgttaactctgccttttggagtgatgctgaccacacggacttcatcgacacagctggtgccatgctgcagtatgctgtcagccttctgaagcccactaaggtctcggctcgccagctgcccccaagcgtagccagggtggatgccaaaagccgagttctgtttcctcttgggttgggacatgctgctgagtacgtcaggcctcgggtggcgctcattggggatgcagcccacagagtccatccgcttgcaggacagggtgtcaacatgggctttggggatatctccagcttggcccatcacctcagtacggcagccttcaatgggaaggacttaggttccgtgagccacctcacaggttatgaaacagaaagacagcgtcacaacactgctcttctggctgctacagacttactaaaaaggctctattctaccagtgcctccccgcttgtgttgctcaggacgtggggcttgcaggccacaaatgcagtgtctccactcaaagaacagattatggcctttgcaagcaaatga
Sequence Length
1407
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,593 Da
NCBI Official Full Name
Homo sapiens coenzyme Q6 homolog, monooxygenase (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
coenzyme Q6, monooxygenase
NCBI Official Symbol
COQ6
NCBI Official Synonym Symbols
CGI10; CGI-10; COQ10D6
NCBI Protein Information
ubiquinone biosynthesis monooxygenase COQ6, mitochondrial
UniProt Protein Name
Ubiquinone biosynthesis monooxygenase COQ6, mitochondrial
UniProt Gene Name
COQ6
UniProt Entry Name
COQ6_HUMAN

NCBI Description

The protein encoded by this gene belongs to the ubiH/COQ6 family. It is an evolutionarily conserved monooxygenase required for the biosynthesis of coenzyme Q10 (or ubiquinone), which is an essential component of the mitochondrial electron transport chain, and one of the most potent lipophilic antioxidants implicated in the protection of cell damage by reactive oxygen species. Knockdown of this gene in mouse and zebrafish results in decreased growth due to increased apoptosis. Mutations in this gene are associated with autosomal recessive coenzyme Q10 deficiency-6 (COQ10D6), which manifests as nephrotic syndrome with sensorineural deafness. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jun 2012]

Uniprot Description

COQ6: Defects in COQ6 are the cause of coenzyme Q10 deficiency, primary, type 6 (COQ10D6). An autosomal recessive disorder characterized by onset in infancy of severe progressive nephrotic syndrome resulting in end-stage renal failure and sensorineural deafness. Renal biopsy usually shows focal segmental glomerulosclerosis. Belongs to the UbiH/COQ6 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Oxidoreductase; EC 1.14.13.-; Cofactor and Vitamin Metabolism - ubiquinone and other terpenoid-quinone biosynthesis; Mitochondrial

Chromosomal Location of Human Ortholog: 14q24.3

Cellular Component: mitochondrion

Molecular Function: monooxygenase activity

Biological Process: ubiquinone biosynthetic process

Disease: Coenzyme Q10 Deficiency, Primary, 6

Research Articles on COQ6

Similar Products

Product Notes

The COQ6 coq6 (Catalog #AAA1278872) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggccc ggcttgtcag ccgatgcggg gctgtgcgtg cagctcccca cagcggcccg ctggtgtcct ggcgcaggtg gtccggcgcc tcaacagaca ccgtgtatga cgtggtggtg tcgggtggag gcctggtggg cgctgccatg gcctgtgcct tgggatatga tattcacttt catgacaaga aaatcctgtt gctcgaagca ggtccaaaga aagtactgga gaaattgtca gaaacttaca gcaacagggt cagctccatt tcccctggct ctgcaacgct tctcagtagt tttggtgcct gggaccatat ctgcaacatg agatacagag cctttcggcg aatgcaggtg tgggacgcct gctcagaggc cctgataatg tttgataagg ataatttaga tgacatgggc tatatcgtgg agaatgatgt catcatgcat gctctcacta agcagttgga ggctgtgtct gaccgagtga cggttctcta caggagcaaa gccattcgct atacctggcc ttgtccattt cctatggccg actccagccc ttgggttcat attaccctag gtgatggcag caccttccag accaaattgt tgataggtgc agatggtcac aactccggag tacggcaggc tgttggaatc cagaatgtga gctggaacta tgaccagtct gctgttgtgg ctactctgca tttatcagag gccacagaaa acaacgtagc ctggcagaga tttcttccct ctgggcctat tgctctgctc ccgctctcag acaccttgag ttccttggtt tggtccacgt cccatgaaca tgcagcagag ctagttagca tggatgagaa aaaatttgtg gatgccgtta actctgcctt ttggagtgat gctgaccaca cggacttcat cgacacagct ggtgccatgc tgcagtatgc tgtcagcctt ctgaagccca ctaaggtctc ggctcgccag ctgcccccaa gcgtagccag ggtggatgcc aaaagccgag ttctgtttcc tcttgggttg ggacatgctg ctgagtacgt caggcctcgg gtggcgctca ttggggatgc agcccacaga gtccatccgc ttgcaggaca gggtgtcaac atgggctttg gggatatctc cagcttggcc catcacctca gtacggcagc cttcaatggg aaggacttag gttccgtgag ccacctcaca ggttatgaaa cagaaagaca gcgtcacaac actgctcttc tggctgctac agacttacta aaaaggctct attctaccag tgcctccccg cttgtgttgc tcaggacgtg gggcttgcag gccacaaatg cagtgtctcc actcaaagaa cagattatgg cctttgcaag caaatga. It is sometimes possible for the material contained within the vial of "COQ6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.