Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

COPZ1 cdna clone

COPZ1 cDNA Clone

Gene Names
COPZ1; COPZ; CGI-120; HSPC181; zeta-COP; zeta1-COP
Synonyms
COPZ1; COPZ1 cDNA Clone; COPZ1 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggcgctgattttggaaccttccctgtatactgtcaaagccatcctgattctggacaatgatggagatcgactttttgccaagtactatgacgacacctaccccagtgtcaaggagcaaaaggcctttgagaagaacattttcaacaagacccatcggactgacagtgaaattgccctcttggaaggcctgacagtggtatacaaaagcagtatagatctctatttctatgtgattggcagctcctatgaaaatgagctgatgcttatggctgttctgaactgtctcttcgactcattgagccagatgctgaggaaaaatgtagaaaagcgagcactgctggagaacatggaggggctgttcttggctgtggatgaaattgtagatggaggggtgatcctagagagtgatccccagcaggtggtacaccgggtggcattaaggggtgaagatgtcccccttacggagcagaccgtgtctcaggtgctgcagtcagccaaagaacagatcaagtggtcactccttcggtga
Sequence Length
534
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,374 Da
NCBI Official Full Name
Homo sapiens coatomer protein complex, subunit zeta 1, mRNA
NCBI Official Synonym Full Names
coatomer protein complex subunit zeta 1
NCBI Official Symbol
COPZ1
NCBI Official Synonym Symbols
COPZ; CGI-120; HSPC181; zeta-COP; zeta1-COP
NCBI Protein Information
coatomer subunit zeta-1
UniProt Protein Name
Coatomer subunit zeta-1
Protein Family
UniProt Gene Name
COPZ1
UniProt Synonym Gene Names
COPZ; Zeta-1 COP
UniProt Entry Name
COPZ1_HUMAN

NCBI Description

This gene encodes a subunit of the cytoplasmic coatamer protein complex, which is involved in autophagy and intracellular protein trafficking. The coatomer protein complex is comprised of seven subunits and functions as the coat protein of coat protein complex (COP)I-vesicles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]

Uniprot Description

COPZ1: The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non- clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. Coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins. In mammals, the coatomer can only be recruited by membranes associated to ADP-ribosylation factors (ARFs), which are small GTP-binding proteins; the complex also influences the Golgi structural integrity, as well as the processing, activity, and endocytic recycling of LDL receptors. Belongs to the adaptor complexes small subunit family.

Protein type: Motility/polarity/chemotaxis; Adaptor/scaffold

Chromosomal Location of Human Ortholog: 12q13.2-q13.3

Cellular Component: COPI vesicle coat; cytosol; endoplasmic reticulum membrane; Golgi membrane; transport vesicle

Biological Process: ER to Golgi vesicle-mediated transport; intra-Golgi vesicle-mediated transport; retrograde vesicle-mediated transport, Golgi to ER

Research Articles on COPZ1

Similar Products

Product Notes

The COPZ1 copz1 (Catalog #AAA1268157) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggcgc tgattttgga accttccctg tatactgtca aagccatcct gattctggac aatgatggag atcgactttt tgccaagtac tatgacgaca cctaccccag tgtcaaggag caaaaggcct ttgagaagaa cattttcaac aagacccatc ggactgacag tgaaattgcc ctcttggaag gcctgacagt ggtatacaaa agcagtatag atctctattt ctatgtgatt ggcagctcct atgaaaatga gctgatgctt atggctgttc tgaactgtct cttcgactca ttgagccaga tgctgaggaa aaatgtagaa aagcgagcac tgctggagaa catggagggg ctgttcttgg ctgtggatga aattgtagat ggaggggtga tcctagagag tgatccccag caggtggtac accgggtggc attaaggggt gaagatgtcc cccttacgga gcagaccgtg tctcaggtgc tgcagtcagc caaagaacag atcaagtggt cactccttcg gtga. It is sometimes possible for the material contained within the vial of "COPZ1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.