Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

COPG2 cdna clone

COPG2 cDNA Clone

Gene Names
COPG2; 2-COP; gamma-2-COP
Synonyms
COPG2; COPG2 cDNA Clone; COPG2 cdna clone
Ordering
For Research Use Only!
Sequence
atgacgcgattgtttcaatctaatgatcaaacattgaggagaatgtgctaccttaccatcaaagaaatggctaccatctctgaggatgtgataattgtcacaagcagtctgactaaagacatgactggaaaagaagatgtataccgaggcccggccatcagagctctctgcaggatcaccgatggaacaatgttgcaagccattgaaagatacatgaagcaggccattgtggataaagtttccagtgtatccagttcagcactggtatcttccctgcacatgatgaagataagctatgatgtggttaagcgctggatcaatgaagcccaagaagctgcatcaagtgataatattatggtccagtaccatgcattgggagtcctgtatcaccttagaaagaatgatcgacttgctgtttccaagatgttgaataagtttactaaatctggtctcaagtcacagtttgcttactgcatgctgatccgaattgccagtcgcttactaaaagaaactgaggatggccatgaaagtccactgtttgatttcattgagagctgcttgcgaaataaacatgaaatggttatttatgaagctgcttcagctatcatccatcttcctaactgcactgcaagagagttggcacctgctgtttcagttcttcaacttttctgtagttctcctaagccagccttgagatatgcagctgtgaggaccttgaacaaggtggcaatgaagcacccctctgctgttactgcctgcaatctggacttagaaaacttaatcacagactcaaacagaagcattgctaccttagccattactacactcctcaaaacaggaagtgagagcagtgtggaccggctcatgaagcagatatcttcttttgtgtctgaaatctcagatgagttcaaggtggtggttgtacaggcaattagtgctctctgtcagaaataccctcgaaagcacagtgtcatgatgactttcctctccaacatgctccgagatgatggaggctttgagtacaagcgggccattgtggactgtataatcagcattgtggaagagaaccctgagagtaaagaagcaggcctagcccacctttgtgaattcattgaggactgtgaacacactgttctggctactaagattctacacttgttgggcaaagagggccctagaacgcctgtcccctccaaatatatccgttttatttttaatagggttgtcctggagaatgaggctgtcagagctgctgctgtgagtgctttggctaaatttggggctcagaatgagagtcttctcccaagcatccttgtactcttacagaggtgtatgatggatactgatgacgaggtacgagacagagctaccttctatctgaatgtgctgcagcagaggcagatggcactaaatgccacatatatctttaatggtttgacggtctctgtaccagggatggaaaaagccttacaccagtacacgttggagccttcagaaaaaccgtttgacatgaaatcaattcctcttgctatggctcctgtctttgaacagaaagcagaaatcacacttgtggctactaagccagagaagttggctccttccaggcaagacattttccaagaacaattggctgccattcctgagtttctgaatataggacccttgttcaagtcttctgagcctgttcaacttacagaagcagagacagaatattttgttcgatgtatcaagcacatgtttaccaatcacatcgtgttccagtttgactgcaccaacactctcaatgaccagctgctggaaaaagtgacagtgcagatggagccatcagattcctatgaagtgctgtcttgtatcccagcccccagccttccttataaccaaccaggaatatgttacactcttgttcgtttgcctgatgatgaccctacagcagttgcaggctcctttagctgcaccatgaagtttacagtccgggactgtgaccctaacactggagttccagatgaggatgggtatgatgatgagtatgtgctggaagatctcgaagtgactgtgtctgaccatattcagaaagtactgaagcctaactttgctgctgcttgggaagaggtgggagatacctttgagaaagaggaaacctttgccctcagttctaccaaaacccttgaagaggctgtcaacaatatcatcacatttctgggcatgcagccatgtgagaggtccgataaagtacctgagaacaagaattcccattcgctctatctggcaggtatattcagaggtggctatgatttattggtgaggtccaggctggccttagccgatggagtgaccatgcaggtgactgtcagaagtaaagagagaacacctgtagatgttatcttagcttctgttggataa
Sequence Length
2400
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
81,483 Da
NCBI Official Full Name
Homo sapiens coatomer protein complex, subunit gamma 2, mRNA
NCBI Official Synonym Full Names
coatomer protein complex subunit gamma 2
NCBI Official Symbol
COPG2
NCBI Official Synonym Symbols
2-COP; gamma-2-COP
NCBI Protein Information
coatomer subunit gamma-2
UniProt Protein Name
Coatomer subunit gamma-2
Protein Family
UniProt Gene Name
COPG2
UniProt Synonym Gene Names
Gamma-2-COP
UniProt Entry Name
COPG2_HUMAN

Uniprot Description

COPG2: The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non- clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. Coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins. In mammals, the coatomer can only be recruited by membranes associated to ADP-ribosylation factors (ARFs), which are small GTP-binding proteins; the complex also influences the Golgi structural integrity, as well as the processing, activity, and endocytic recycling of LDL receptors. Belongs to the COPG family.

Protein type: Motility/polarity/chemotaxis; Vesicle

Chromosomal Location of Human Ortholog: 7q32

Cellular Component: COPI vesicle coat; cytosol; endoplasmic reticulum membrane; Golgi membrane; transport vesicle

Biological Process: ER to Golgi vesicle-mediated transport; intra-Golgi vesicle-mediated transport; retrograde vesicle-mediated transport, Golgi to ER

Research Articles on COPG2

Similar Products

Product Notes

The COPG2 copg2 (Catalog #AAA1269580) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacgcgat tgtttcaatc taatgatcaa acattgagga gaatgtgcta ccttaccatc aaagaaatgg ctaccatctc tgaggatgtg ataattgtca caagcagtct gactaaagac atgactggaa aagaagatgt ataccgaggc ccggccatca gagctctctg caggatcacc gatggaacaa tgttgcaagc cattgaaaga tacatgaagc aggccattgt ggataaagtt tccagtgtat ccagttcagc actggtatct tccctgcaca tgatgaagat aagctatgat gtggttaagc gctggatcaa tgaagcccaa gaagctgcat caagtgataa tattatggtc cagtaccatg cattgggagt cctgtatcac cttagaaaga atgatcgact tgctgtttcc aagatgttga ataagtttac taaatctggt ctcaagtcac agtttgctta ctgcatgctg atccgaattg ccagtcgctt actaaaagaa actgaggatg gccatgaaag tccactgttt gatttcattg agagctgctt gcgaaataaa catgaaatgg ttatttatga agctgcttca gctatcatcc atcttcctaa ctgcactgca agagagttgg cacctgctgt ttcagttctt caacttttct gtagttctcc taagccagcc ttgagatatg cagctgtgag gaccttgaac aaggtggcaa tgaagcaccc ctctgctgtt actgcctgca atctggactt agaaaactta atcacagact caaacagaag cattgctacc ttagccatta ctacactcct caaaacagga agtgagagca gtgtggaccg gctcatgaag cagatatctt cttttgtgtc tgaaatctca gatgagttca aggtggtggt tgtacaggca attagtgctc tctgtcagaa ataccctcga aagcacagtg tcatgatgac tttcctctcc aacatgctcc gagatgatgg aggctttgag tacaagcggg ccattgtgga ctgtataatc agcattgtgg aagagaaccc tgagagtaaa gaagcaggcc tagcccacct ttgtgaattc attgaggact gtgaacacac tgttctggct actaagattc tacacttgtt gggcaaagag ggccctagaa cgcctgtccc ctccaaatat atccgtttta tttttaatag ggttgtcctg gagaatgagg ctgtcagagc tgctgctgtg agtgctttgg ctaaatttgg ggctcagaat gagagtcttc tcccaagcat ccttgtactc ttacagaggt gtatgatgga tactgatgac gaggtacgag acagagctac cttctatctg aatgtgctgc agcagaggca gatggcacta aatgccacat atatctttaa tggtttgacg gtctctgtac cagggatgga aaaagcctta caccagtaca cgttggagcc ttcagaaaaa ccgtttgaca tgaaatcaat tcctcttgct atggctcctg tctttgaaca gaaagcagaa atcacacttg tggctactaa gccagagaag ttggctcctt ccaggcaaga cattttccaa gaacaattgg ctgccattcc tgagtttctg aatataggac ccttgttcaa gtcttctgag cctgttcaac ttacagaagc agagacagaa tattttgttc gatgtatcaa gcacatgttt accaatcaca tcgtgttcca gtttgactgc accaacactc tcaatgacca gctgctggaa aaagtgacag tgcagatgga gccatcagat tcctatgaag tgctgtcttg tatcccagcc cccagccttc cttataacca accaggaata tgttacactc ttgttcgttt gcctgatgat gaccctacag cagttgcagg ctcctttagc tgcaccatga agtttacagt ccgggactgt gaccctaaca ctggagttcc agatgaggat gggtatgatg atgagtatgt gctggaagat ctcgaagtga ctgtgtctga ccatattcag aaagtactga agcctaactt tgctgctgct tgggaagagg tgggagatac ctttgagaaa gaggaaacct ttgccctcag ttctaccaaa acccttgaag aggctgtcaa caatatcatc acatttctgg gcatgcagcc atgtgagagg tccgataaag tacctgagaa caagaattcc cattcgctct atctggcagg tatattcaga ggtggctatg atttattggt gaggtccagg ctggccttag ccgatggagt gaccatgcag gtgactgtca gaagtaaaga gagaacacct gtagatgtta tcttagcttc tgttggataa. It is sometimes possible for the material contained within the vial of "COPG2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.