Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

COPB1 cdna clone

COPB1 cDNA Clone

Gene Names
COPB1; COPB
Synonyms
COPB1; COPB1 cDNA Clone; COPB1 cdna clone
Ordering
For Research Use Only!
Sequence
atgacggcggctgagaacgtatgctacacgttaattaacgtgccaatggattcagaaccaccatctgaaattagcttaaaaaatgatctagaaaaaggagatgtaaagtcaaagactgaagctttgaagaaagtaatcattatgattctgaatggtgaaaaacttcctggacttctgatgaccatcattcgttttgtgctacctcttcaggatcacactatcaagaaattacttctggtattttgggaaattgttcctaaaacaactccagatgggagacttttacatgagatgatccttgtatgtgatgcatacagaaaggatcttcaacatcctaatgaatttattcgaggatctactcttcgttttctttgcaaattgaaagaagcagaattgctagaacctttaatgccagctattcgtgcatgtttggagcatcgacacagctatgttagaagaaatgctgttttggccatctataccatctatagaaattttgaacatcttatacctgatgctcctgaactgatacatgattttctggtgaatgagaaggatgcaagttgcaaaaggaatgcatttatgatgctaattcatgcagatcaggatcgagctttggattacttaagtacttgcattgatcaagttcaaacatttggagacattctgcagctggttattgttgaactgatttataaggtctgtcatgctaatccatcagaaagagctcgttttattcgctgcatctataacttattacagtcatccagccctgctgtaaaatatgaagctgctgggacattagtgacactctctagtgcaccaactgcaatcaaggctgctgctcagtgttacattgatttaattattaaggagagcgacaacaatgtaaaactcatagttttggatcgcttgatagaattaaaagagcatcctgctcatgaacgagtactacaggatctggttatggatatcctaagagtattgagcacaccagacttagaagtacgaaagaaaactctgcagttagcactggatcttgtctcttctagaaatgttgaagagctggttattgtcctgaagaaggaagtgataaaaacaaataatgtgtctgagcatgaagatactgacaaatacagacaactcctagtgcgaacattgcattcctgttctgtccgatttccagatatggctgcaaatgttattcctgtgttaatggaatttctcagtgacaacaacgaagcagcagctgctgatgtcttggagtttgttcgtgaagccattcagcgctttgataacctgagaatgcttattgttgagaagatgcttgaagtctttcatgctattaaatctgtcaagatttaccgaggagcattatggatcctgggagaatactgtagtaccaaggaagacattcagagtgtgatgactgagatccgcaggtcccttggagagatcccaattgtagagtcagaaataaagaaagaagctggtgaattaaaacctgaagaagaaataactgtagggccagttcagaaattggttactgaaatgggtacctatgcaactcagagtgcccttagcagttctagacccaccaagaaagaggaagacagacctcccttgagaggattccttctggatggagatttctttgttgctgcctcccttgccacaactctgaccaagattgcattgcgctatgtagctttggttcaggagaagaaaaagcaaaattcttttgttgctgaggctatgttgctcatggctactatcctgcatttgggaaaatcctctcttcctaagaagccaattactgatgatgatgtggatcgaatttccctgtgcctcaaggtcttgtctgaatgttcacctttaatgaatgacattttcaataaggaatgcagacagtccctttctcacatgttatctgctaaactagaagaagagaaattatcccaaaagaaagaatctgaaaagaggaatgtgacagtacagcctgatgaccccatttccttcatgcaactaactgctaagaatgaaatgaactgcaaggaagatcagtttcagctgagtttactggcagcaatgggtaacacacagaggaaagaggcagcagatcccctagcatctaaacttaacaaggtcacccaattgacaggtttctcagatcctgtatatgcagaagcttacgttcatgtcaaccaatatgatattgtcctggatgtacttgttgtgaaccaaaccagtgatactttgcagaattgcacattagaactagctacactaggggatctgaaacttgtggaaaagccgtctcctttgactcttgctcctcatgacttcgcaaatattaaagctaacgtcaaagtagcatcaacagaaaatggaataatttttggtaatatagtttatgatgtctctggagcagcaagtgacagaaattgtgtggttctcagtgatattcacatcgacatcatggactatatccagcctgcaacttgcactgatgcagaattccgtcagatgtgggccgaatttgaatgggaaaacaaagtgacagttaacaccaacatggttgatttaaatgactacttacagcacatattaaagtcaaccaatatgaaatgcctgactccagaaaaggccctttctggttactgtggctttatggcagccaacctttatgctcgttccatatttggtgaagatgcacttgcaaatgtcagcattgagaagccaattcaccagggaccagatgctgctgttaccggccatataagaattcgtgcaaagagccagggaatggccttaagtcttggagataaaatcaacttgtcacagaagaaaactagtatataa
Sequence Length
2862
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
107,142 Da
NCBI Official Full Name
Homo sapiens coatomer protein complex, subunit beta 1, mRNA
NCBI Official Synonym Full Names
coatomer protein complex subunit beta 1
NCBI Official Symbol
COPB1
NCBI Official Synonym Symbols
COPB
NCBI Protein Information
coatomer subunit beta
UniProt Protein Name
Coatomer subunit beta
UniProt Gene Name
COPB1
UniProt Synonym Gene Names
COPB; Beta-COP
UniProt Entry Name
COPB_HUMAN

NCBI Description

This gene encodes a protein subunit of the coatomer complex associated with non-clathrin coated vesicles. The coatomer complex, also known as the coat protein complex 1, forms in the cytoplasm and is recruited to the Golgi by activated guanosine triphosphatases. Once at the Golgi membrane, the coatomer complex may assist in the movement of protein and lipid components back to the endoplasmic reticulum. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2009]

Uniprot Description

COPB1: The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non- clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. Coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins. In mammals, the coatomer can only be recruited by membranes associated to ADP-ribosylation factors (ARFs), which are small GTP-binding proteins; the complex also influences the Golgi structural integrity, as well as the processing, activity, and endocytic recycling of LDL receptors. Plays a functional role in facilitating the transport of kappa- type opioid receptor mRNAs into axons and enhances translation of these proteins. Required for limiting lipid storage in lipid droplets. Involved in lipid homeostasis by regulating the presence of perilipin family members PLIN2 and PLIN3 at the lipid droplet surface and promoting the association of adipocyte surface triglyceride lipase (PNPLA2) with the lipid droplet to mediate lipolysis. Involved in the Golgi disassembly and reassembly processes during cell cycle. Involved in autophagy by playing a role in early endosome function. Plays a role in organellar compartmentalization of secretory compartments including endoplasmic reticulum (ER)-Golgi intermediate compartment (ERGIC), Golgi, trans-Golgi network (TGN) and recycling endosomes, and in biosynthetic transport of CAV1. Promotes degradation of Nef cellular targets CD4 and MHC class I antigens by facilitating their trafficking to degradative compartments.

Protein type: Motility/polarity/chemotaxis; Vesicle

Chromosomal Location of Human Ortholog: 11p15.2

Cellular Component: COPI vesicle coat; cytoplasm; cytosol; endoplasmic reticulum membrane; Golgi apparatus; Golgi membrane; Golgi-associated vesicle; intracellular membrane-bound organelle; membrane; transport vesicle

Molecular Function: protein binding

Biological Process: ER to Golgi vesicle-mediated transport; intra-Golgi vesicle-mediated transport; retrograde vesicle-mediated transport, Golgi to ER

Similar Products

Product Notes

The COPB1 copb1 (Catalog #AAA1267154) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacggcgg ctgagaacgt atgctacacg ttaattaacg tgccaatgga ttcagaacca ccatctgaaa ttagcttaaa aaatgatcta gaaaaaggag atgtaaagtc aaagactgaa gctttgaaga aagtaatcat tatgattctg aatggtgaaa aacttcctgg acttctgatg accatcattc gttttgtgct acctcttcag gatcacacta tcaagaaatt acttctggta ttttgggaaa ttgttcctaa aacaactcca gatgggagac ttttacatga gatgatcctt gtatgtgatg catacagaaa ggatcttcaa catcctaatg aatttattcg aggatctact cttcgttttc tttgcaaatt gaaagaagca gaattgctag aacctttaat gccagctatt cgtgcatgtt tggagcatcg acacagctat gttagaagaa atgctgtttt ggccatctat accatctata gaaattttga acatcttata cctgatgctc ctgaactgat acatgatttt ctggtgaatg agaaggatgc aagttgcaaa aggaatgcat ttatgatgct aattcatgca gatcaggatc gagctttgga ttacttaagt acttgcattg atcaagttca aacatttgga gacattctgc agctggttat tgttgaactg atttataagg tctgtcatgc taatccatca gaaagagctc gttttattcg ctgcatctat aacttattac agtcatccag ccctgctgta aaatatgaag ctgctgggac attagtgaca ctctctagtg caccaactgc aatcaaggct gctgctcagt gttacattga tttaattatt aaggagagcg acaacaatgt aaaactcata gttttggatc gcttgataga attaaaagag catcctgctc atgaacgagt actacaggat ctggttatgg atatcctaag agtattgagc acaccagact tagaagtacg aaagaaaact ctgcagttag cactggatct tgtctcttct agaaatgttg aagagctggt tattgtcctg aagaaggaag tgataaaaac aaataatgtg tctgagcatg aagatactga caaatacaga caactcctag tgcgaacatt gcattcctgt tctgtccgat ttccagatat ggctgcaaat gttattcctg tgttaatgga atttctcagt gacaacaacg aagcagcagc tgctgatgtc ttggagtttg ttcgtgaagc cattcagcgc tttgataacc tgagaatgct tattgttgag aagatgcttg aagtctttca tgctattaaa tctgtcaaga tttaccgagg agcattatgg atcctgggag aatactgtag taccaaggaa gacattcaga gtgtgatgac tgagatccgc aggtcccttg gagagatccc aattgtagag tcagaaataa agaaagaagc tggtgaatta aaacctgaag aagaaataac tgtagggcca gttcagaaat tggttactga aatgggtacc tatgcaactc agagtgccct tagcagttct agacccacca agaaagagga agacagacct cccttgagag gattccttct ggatggagat ttctttgttg ctgcctccct tgccacaact ctgaccaaga ttgcattgcg ctatgtagct ttggttcagg agaagaaaaa gcaaaattct tttgttgctg aggctatgtt gctcatggct actatcctgc atttgggaaa atcctctctt cctaagaagc caattactga tgatgatgtg gatcgaattt ccctgtgcct caaggtcttg tctgaatgtt cacctttaat gaatgacatt ttcaataagg aatgcagaca gtccctttct cacatgttat ctgctaaact agaagaagag aaattatccc aaaagaaaga atctgaaaag aggaatgtga cagtacagcc tgatgacccc atttccttca tgcaactaac tgctaagaat gaaatgaact gcaaggaaga tcagtttcag ctgagtttac tggcagcaat gggtaacaca cagaggaaag aggcagcaga tcccctagca tctaaactta acaaggtcac ccaattgaca ggtttctcag atcctgtata tgcagaagct tacgttcatg tcaaccaata tgatattgtc ctggatgtac ttgttgtgaa ccaaaccagt gatactttgc agaattgcac attagaacta gctacactag gggatctgaa acttgtggaa aagccgtctc ctttgactct tgctcctcat gacttcgcaa atattaaagc taacgtcaaa gtagcatcaa cagaaaatgg aataattttt ggtaatatag tttatgatgt ctctggagca gcaagtgaca gaaattgtgt ggttctcagt gatattcaca tcgacatcat ggactatatc cagcctgcaa cttgcactga tgcagaattc cgtcagatgt gggccgaatt tgaatgggaa aacaaagtga cagttaacac caacatggtt gatttaaatg actacttaca gcacatatta aagtcaacca atatgaaatg cctgactcca gaaaaggccc tttctggtta ctgtggcttt atggcagcca acctttatgc tcgttccata tttggtgaag atgcacttgc aaatgtcagc attgagaagc caattcacca gggaccagat gctgctgtta ccggccatat aagaattcgt gcaaagagcc agggaatggc cttaagtctt ggagataaaa tcaacttgtc acagaagaaa actagtatat aa. It is sometimes possible for the material contained within the vial of "COPB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.