Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

COL8A1 cdna clone

COL8A1 cDNA Clone

Gene Names
COL8A1; C3orf7
Synonyms
COL8A1; COL8A1 cDNA Clone; COL8A1 cdna clone
Ordering
For Research Use Only!
Sequence
atggctgtgctgcctggccctctgcagctgctgggagtgctgcttaccatttccctgagttccatcaggctcattcaggctggtgcctactatgggatcaagccgctgccacctcaaattcctcctcagatgccaccacaaattccacaataccagcccctgggtcagcaagtacctcacatgcctttggccaaagatggccttgccatgggcaaggagatgccccacttgcagtatggcaaagagtatccacacctaccccaatatatgaaggaaattcaaccggcgccaagaatgggcaaggaagccgtacccaagaaaggcaaagaaataccattagccagtttacgaggggaacaaggtccccgtggagagcctggcccaagaggaccacctgggccccctggtttgccaggtcatgggatacctggaattaaaggaaaaccagggccacagggatatccaggagttggaaagccaggtatgcctggaatgccagggaagccaggagccatgggcatgcctggggcaaaaggagaaattggacagaaaggggaaattgggcctatggggatcccaggaccacaaggacctccagggcctcatggacttcctggcattgggaagccaggtgggccagggttaccagggcaaccaggaccaaagggtgatcgaggacccaaaggactaccaggacctcaaggccttcggggtcctaaaggagacaagggcttcgggatgccaggtgcgccaggtgtaaaggggcctccagggatgcacggccctcccggccctgttggactgccaggagtgggcaaaccaggagtgacaggcttccctgggccccagggccccctgggaaagccaggggctccaggagaacctgggccacaaggccctattggggtaccgggggttcaaggacctcctgggatacccggaattggaaagccaggccaggatgggatcccaggccagccaggatttccaggtggcaaaggggagcaaggactgccagggctaccaggacccccaggccttccagggattgggaaaccaggcttcccaggacccaaaggtgaccggggcatgggaggtgttcctggggctcttggaccaagaggggagaaaggaccaataggtgccccaggaatagggggtcctccaggagagccaggcctgcctggaatcccaggtcctatgggccctccaggtgctattggttttcctggacccaaaggagaaggtgggattgtagggccacaggggccaccaggtcccaagggtgagccagggcttcaaggcttcccaggaaagccaggtttccttggtgaagtagggcctcctggcatgaggggtttgccaggtcccatagggcccaagggggaagctgggcaaaaaggtgtaccaggactccctggtgttccagggcttctcggacctaagggagagccaggaatcccaggggatcagggtttacagggccccccaggtatcccagggattgggggccctagtggccccattggaccacctgggattccaggccccaaaggggagccgggcctcccagggccccctgggttccctggtatagggaaacccggagtggcaggacttcatggccccccagggaagcctggtgcccttggtcctcaaggccagcctggccttccaggacccccaggccctccaggacctccaggacccccagctgtgatgccccctacaccaccaccccagggagagtatctgccagatatggggctgggaattgatggcgtgaaacccccccatgcctacggggctaagaaaggcaagaatggagggccagcctatgagatgcctgcatttaccgccgagctaaccgcacctttcccaccggtgggggccccagtgaagtttaacaaactgctgtataacggcagacagaactacaacccgcagacaggcatcttcacctgtgaggtccctggtgtctactactttgcataccacgttcactgcaaggggggcaacgtgtgggttgctctattcaagaacaacgagcccgtgatgtacacgtacgacgagtacaaaaagggcttcctggaccaggcatctgggagtgcagtgctgctgctcaggcccggagaccgggtgttcctccagatgccctcagaacaggctgcaggactgtatgccgggcagtatgtccactcctccttttcaggatatttattgtatcccatgtaa
Sequence Length
2235
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
73,364 Da
NCBI Official Full Name
Homo sapiens collagen, type VIII, alpha 1, mRNA
NCBI Official Synonym Full Names
collagen type VIII alpha 1 chain
NCBI Official Symbol
COL8A1
NCBI Official Synonym Symbols
C3orf7
NCBI Protein Information
collagen alpha-1(VIII) chain
UniProt Protein Name
Collagen alpha-1(VIII) chain
Protein Family
UniProt Gene Name
COL8A1
UniProt Synonym Gene Names
C3orf7
UniProt Entry Name
CO8A1_HUMAN

NCBI Description

This gene encodes one of the two alpha chains of type VIII collagen. The gene product is a short chain collagen and a major component of the basement membrane of the corneal endothelium. The type VIII collagen fibril can be either a homo- or a heterotrimer. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Dec 2011]

Uniprot Description

COL8A1: Macromolecular component of the subendothelium. Major component of the Descemet's membrane (basement membrane) of corneal endothelial cells. Also component of the endothelia of blood vessels. Necessary for migration and proliferation of vascular smooth muscle cells and thus, has a potential role in the maintenance of vessel wall integrity and structure, in particular in atherogenesis.

Protein type: Secreted, signal peptide; Secreted; Extracellular matrix

Chromosomal Location of Human Ortholog: 3q12.3

Cellular Component: collagen type VIII; endoplasmic reticulum lumen; extracellular matrix; extracellular region; intracellular membrane-bound organelle

Molecular Function: protein binding

Biological Process: collagen catabolic process; extracellular matrix organization and biogenesis

Research Articles on COL8A1

Similar Products

Product Notes

The COL8A1 col8a1 (Catalog #AAA1274339) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgtgc tgcctggccc tctgcagctg ctgggagtgc tgcttaccat ttccctgagt tccatcaggc tcattcaggc tggtgcctac tatgggatca agccgctgcc acctcaaatt cctcctcaga tgccaccaca aattccacaa taccagcccc tgggtcagca agtacctcac atgcctttgg ccaaagatgg ccttgccatg ggcaaggaga tgccccactt gcagtatggc aaagagtatc cacacctacc ccaatatatg aaggaaattc aaccggcgcc aagaatgggc aaggaagccg tacccaagaa aggcaaagaa ataccattag ccagtttacg aggggaacaa ggtccccgtg gagagcctgg cccaagagga ccacctgggc cccctggttt gccaggtcat gggatacctg gaattaaagg aaaaccaggg ccacagggat atccaggagt tggaaagcca ggtatgcctg gaatgccagg gaagccagga gccatgggca tgcctggggc aaaaggagaa attggacaga aaggggaaat tgggcctatg gggatcccag gaccacaagg acctccaggg cctcatggac ttcctggcat tgggaagcca ggtgggccag ggttaccagg gcaaccagga ccaaagggtg atcgaggacc caaaggacta ccaggacctc aaggccttcg gggtcctaaa ggagacaagg gcttcgggat gccaggtgcg ccaggtgtaa aggggcctcc agggatgcac ggccctcccg gccctgttgg actgccagga gtgggcaaac caggagtgac aggcttccct gggccccagg gccccctggg aaagccaggg gctccaggag aacctgggcc acaaggccct attggggtac cgggggttca aggacctcct gggatacccg gaattggaaa gccaggccag gatgggatcc caggccagcc aggatttcca ggtggcaaag gggagcaagg actgccaggg ctaccaggac ccccaggcct tccagggatt gggaaaccag gcttcccagg acccaaaggt gaccggggca tgggaggtgt tcctggggct cttggaccaa gaggggagaa aggaccaata ggtgccccag gaataggggg tcctccagga gagccaggcc tgcctggaat cccaggtcct atgggccctc caggtgctat tggttttcct ggacccaaag gagaaggtgg gattgtaggg ccacaggggc caccaggtcc caagggtgag ccagggcttc aaggcttccc aggaaagcca ggtttccttg gtgaagtagg gcctcctggc atgaggggtt tgccaggtcc catagggccc aagggggaag ctgggcaaaa aggtgtacca ggactccctg gtgttccagg gcttctcgga cctaagggag agccaggaat cccaggggat cagggtttac agggcccccc aggtatccca gggattgggg gccctagtgg ccccattgga ccacctggga ttccaggccc caaaggggag ccgggcctcc cagggccccc tgggttccct ggtataggga aacccggagt ggcaggactt catggccccc cagggaagcc tggtgccctt ggtcctcaag gccagcctgg ccttccagga cccccaggcc ctccaggacc tccaggaccc ccagctgtga tgccccctac accaccaccc cagggagagt atctgccaga tatggggctg ggaattgatg gcgtgaaacc cccccatgcc tacggggcta agaaaggcaa gaatggaggg ccagcctatg agatgcctgc atttaccgcc gagctaaccg cacctttccc accggtgggg gccccagtga agtttaacaa actgctgtat aacggcagac agaactacaa cccgcagaca ggcatcttca cctgtgaggt ccctggtgtc tactactttg cataccacgt tcactgcaag gggggcaacg tgtgggttgc tctattcaag aacaacgagc ccgtgatgta cacgtacgac gagtacaaaa agggcttcct ggaccaggca tctgggagtg cagtgctgct gctcaggccc ggagaccggg tgttcctcca gatgccctca gaacaggctg caggactgta tgccgggcag tatgtccact cctccttttc aggatattta ttgtatccca tgtaa. It is sometimes possible for the material contained within the vial of "COL8A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.