Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

COL6A1 cdna clone

COL6A1 cDNA Clone

Gene Names
COL6A1; OPLL; BTHLM1; UCHMD1
Synonyms
COL6A1; COL6A1 cDNA Clone; COL6A1 cdna clone
Ordering
For Research Use Only!
Sequence
atgagggcggcccgtgctctgctgcccctgctgctgcaggcctgctggacagccgcgcaggatgagccggagaccccgagggccgtggccttccaggactgccccgtggacctgttctttgtgctggacacctctgagagcgtggccctgaggctgaagccctacggggccctcgtggacaaagtcaagtccttcaccaagcgcttcatcgacaacctgagggacaggtactaccgctgtgaccgaaacctggtgtggaacgcaggcgcgctgcactacagtgacgaggtggagatcatccaaggcctcacgcgcatgcctggcggccgcgacgcactcaaaagcagcgtggacgcggtcaagtactttgggaagggcacctacaccgactgcgctatcaagaaggggctggagcagctcctcgtggggggctcccacctgaaggagaataagtacctgattgtggtgaccgacgggcaccccctggagggctacaaggaaccctgtggggggctggaggatgctgtgaacgaggccaagcacctgggcgtcaaagtcttctcggtggccatcacacccgaccacctggagccgcgtctgagcatcatcgccacggaccacacgtaccggcgcaacttcacggcggctgactggggccagagccgcgacgcagaggaggccatcagccagaccatcgacaccatcgtggacatgatcaaaaataacgtggagcaagtgtgctgctccttcgaatgccagcctgcaagaggacctccggggctccggggcgaccccggctttgagggagaacgaggcaagccggggctcccaggagagaagggagaagccggagatcctggaagacccggggacctcggacctgttgggtaccagggaatgaagggagaaaaagggagccgtggggagaagggctccaggggacccaagggctacaagggagagaagggcaagcgtggcatcgacggggtggacggcgtgaagggggagatggggtacccaggcctgccaggctgcaagggctcgcccgggtttgacggcattcaaggaccccctggccccaagggagaccccggcgcctttggactgaaaggagaaaagggcgagcctggagctgacggggaggcggggagaccagggagctcgggaccatctggagacgagggccagccgggagagcctgggccccccggagagaaaggagaggcgggcgacgaggggaacccaggacctgacggtgcccccggggagcggggtggccctggagagagaggaccacgggggaccccaggcacacggggaccaagaggagaccctggtgaagctggcccgcagggtgatcagggaagagaaggccccgttggtgtccctggagacccgggcgaggctggccctatcggacctaaaggctaccgaggcgatgagggtcccccagggtccgagggtgccagaggagccccaggacctgccggaccccctggagacccggggctgatgggtgaaaggggagaagacggccccgctggaaatggcaccgagggcttccccggcttccccgggtatccgggcaacaggggcgctcccgggataaacggcacgaagggctaccccggcctcaagggggacgagggagaagccggggaccccggagacgataacaacgacattgcaccccgaggagtcaaaggagcaaaggggtaccggggtcccgagggcccccagggacccccaggacaccaaggaccgcctgggccggacgaatgcgagattttggacatcatcatgaaaatgtgctcttgctgtgaatgcaagtgcggccccatcgacctcctgttcgtgctggacagctcagagagcattggcctgcagaacttcgagattgccaaggacttcgtcgtcaaggtcatcgaccggctgagccgggacgagctggtcaagttcgagccagggcagtcgtacgcgggtgtggtgcagtacagccacagccagatgcaggagcacgtgagcctgcgcagccccagcatccggaacgtgcaggagctcaaggaagccatcaagagcctgcagtggatggcgggcggcaccttcacgggggaggccctgcagtacacgcgggaccagctgctgccgcccagcccgaacaaccgcatcgccctggtcatcactgacgggcgctcagacactcagagggacaccacaccgctcaacgtgctctgcagccccggcatccaggtggtctccgtgggcatcaaagacgtgtttgacttcatcccaggctcagaccagctcaatgtcatttcttgccaaggcctggcaccatcccagggccggcccggcctctcgctggtcaaggagaactatgcagagctgctggaggatgccttcctgaagaatgtcaccgcccagatctgcatagacaagaagtgtccagattacacctgccccatcacgttctcctccccggctgacatcaccatcctgctggacggctccgccagcgtgggcagccacaactttgacaccaccaagcgcttcgccaagcgcctggccgagcgcttcctcacagcgggcaggacggaccccgcccacgacgtgcgggtggcggtggtgcagtacagcggcacgggccagcagcgcccagagcgggcgtcgctgcagttcctgcagaactacacggccctggccagtgccgtcgatgccatggactttatcaacgacgccaccgacgtcaacgatgccctgggctatgtgacccgcttctaccgcgaggcctcgtccggcgctgccaagaagaggctgctgctcttctcagatggcaactcgcagggcgccacgcccgctgccatcgagaaggccgtgcaggaagcccagcgggcaggcatcgagatcttcgtggtggtcgtgggccgccaggtgaatgagccccacatccgcgtcctggtcaccggcaagacggccgagtacgacgtggcctacggcgagagccacctgttccgtgtccccagctaccaggccctgctccgcggtgtcttccaccagacagtctccaggaaggtggcgctgggctag
Sequence Length
3087
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
108,529 Da
NCBI Official Full Name
Homo sapiens collagen, type VI, alpha 1, mRNA
NCBI Official Synonym Full Names
collagen type VI alpha 1 chain
NCBI Official Symbol
COL6A1
NCBI Official Synonym Symbols
OPLL; BTHLM1; UCHMD1
NCBI Protein Information
collagen alpha-1(VI) chain
UniProt Protein Name
Collagen alpha-1(VI) chain
Protein Family
UniProt Gene Name
COL6A1
UniProt Entry Name
CO6A1_HUMAN

NCBI Description

The collagens are a superfamily of proteins that play a role in maintaining the integrity of various tissues. Collagens are extracellular matrix proteins and have a triple-helical domain as their common structural element. Collagen VI is a major structural component of microfibrils. The basic structural unit of collagen VI is a heterotrimer of the alpha1(VI), alpha2(VI), and alpha3(VI) chains. The alpha2(VI) and alpha3(VI) chains are encoded by the COL6A2 and COL6A3 genes, respectively. The protein encoded by this gene is the alpha 1 subunit of type VI collagen (alpha1(VI) chain). Mutations in the genes that code for the collagen VI subunits result in the autosomal dominant disorder, Bethlem myopathy. [provided by RefSeq, Jul 2008]

Uniprot Description

COL6A1: Collagen VI acts as a cell-binding protein. Defects in COL6A1 are a cause of Bethlem myopathy (BM). BM is a rare autosomal dominant proximal myopathy characterized by early childhood onset (complete penetrance by the age of 5) and joint contractures most frequently affecting the elbows and ankles. Defects in COL6A1 are a cause of Ullrich congenital muscular dystrophy (UCMD); also known as Ullrich scleroatonic muscular dystrophy. UCMD is an autosomal recessive congenital myopathy characterized by muscle weakness and multiple joint contractures, generally noted at birth or early infancy. The clinical course is more severe than in Bethlem myopathy. Belongs to the type VI collagen family.

Protein type: Extracellular matrix; Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 21q22.3

Cellular Component: endoplasmic reticulum lumen; extracellular matrix; extracellular region; lysosomal membrane; membrane; protein complex

Molecular Function: platelet-derived growth factor binding

Biological Process: collagen catabolic process; extracellular matrix organization and biogenesis; osteoblast differentiation

Disease: Bethlem Myopathy; Ullrich Congenital Muscular Dystrophy

Research Articles on COL6A1

Similar Products

Product Notes

The COL6A1 col6a1 (Catalog #AAA1276495) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagggcgg cccgtgctct gctgcccctg ctgctgcagg cctgctggac agccgcgcag gatgagccgg agaccccgag ggccgtggcc ttccaggact gccccgtgga cctgttcttt gtgctggaca cctctgagag cgtggccctg aggctgaagc cctacggggc cctcgtggac aaagtcaagt ccttcaccaa gcgcttcatc gacaacctga gggacaggta ctaccgctgt gaccgaaacc tggtgtggaa cgcaggcgcg ctgcactaca gtgacgaggt ggagatcatc caaggcctca cgcgcatgcc tggcggccgc gacgcactca aaagcagcgt ggacgcggtc aagtactttg ggaagggcac ctacaccgac tgcgctatca agaaggggct ggagcagctc ctcgtggggg gctcccacct gaaggagaat aagtacctga ttgtggtgac cgacgggcac cccctggagg gctacaagga accctgtggg gggctggagg atgctgtgaa cgaggccaag cacctgggcg tcaaagtctt ctcggtggcc atcacacccg accacctgga gccgcgtctg agcatcatcg ccacggacca cacgtaccgg cgcaacttca cggcggctga ctggggccag agccgcgacg cagaggaggc catcagccag accatcgaca ccatcgtgga catgatcaaa aataacgtgg agcaagtgtg ctgctccttc gaatgccagc ctgcaagagg acctccgggg ctccggggcg accccggctt tgagggagaa cgaggcaagc cggggctccc aggagagaag ggagaagccg gagatcctgg aagacccggg gacctcggac ctgttgggta ccagggaatg aagggagaaa aagggagccg tggggagaag ggctccaggg gacccaaggg ctacaaggga gagaagggca agcgtggcat cgacggggtg gacggcgtga agggggagat ggggtaccca ggcctgccag gctgcaaggg ctcgcccggg tttgacggca ttcaaggacc ccctggcccc aagggagacc ccggcgcctt tggactgaaa ggagaaaagg gcgagcctgg agctgacggg gaggcgggga gaccagggag ctcgggacca tctggagacg agggccagcc gggagagcct gggccccccg gagagaaagg agaggcgggc gacgagggga acccaggacc tgacggtgcc cccggggagc ggggtggccc tggagagaga ggaccacggg ggaccccagg cacacgggga ccaagaggag accctggtga agctggcccg cagggtgatc agggaagaga aggccccgtt ggtgtccctg gagacccggg cgaggctggc cctatcggac ctaaaggcta ccgaggcgat gagggtcccc cagggtccga gggtgccaga ggagccccag gacctgccgg accccctgga gacccggggc tgatgggtga aaggggagaa gacggccccg ctggaaatgg caccgagggc ttccccggct tccccgggta tccgggcaac aggggcgctc ccgggataaa cggcacgaag ggctaccccg gcctcaaggg ggacgaggga gaagccgggg accccggaga cgataacaac gacattgcac cccgaggagt caaaggagca aaggggtacc ggggtcccga gggcccccag ggacccccag gacaccaagg accgcctggg ccggacgaat gcgagatttt ggacatcatc atgaaaatgt gctcttgctg tgaatgcaag tgcggcccca tcgacctcct gttcgtgctg gacagctcag agagcattgg cctgcagaac ttcgagattg ccaaggactt cgtcgtcaag gtcatcgacc ggctgagccg ggacgagctg gtcaagttcg agccagggca gtcgtacgcg ggtgtggtgc agtacagcca cagccagatg caggagcacg tgagcctgcg cagccccagc atccggaacg tgcaggagct caaggaagcc atcaagagcc tgcagtggat ggcgggcggc accttcacgg gggaggccct gcagtacacg cgggaccagc tgctgccgcc cagcccgaac aaccgcatcg ccctggtcat cactgacggg cgctcagaca ctcagaggga caccacaccg ctcaacgtgc tctgcagccc cggcatccag gtggtctccg tgggcatcaa agacgtgttt gacttcatcc caggctcaga ccagctcaat gtcatttctt gccaaggcct ggcaccatcc cagggccggc ccggcctctc gctggtcaag gagaactatg cagagctgct ggaggatgcc ttcctgaaga atgtcaccgc ccagatctgc atagacaaga agtgtccaga ttacacctgc cccatcacgt tctcctcccc ggctgacatc accatcctgc tggacggctc cgccagcgtg ggcagccaca actttgacac caccaagcgc ttcgccaagc gcctggccga gcgcttcctc acagcgggca ggacggaccc cgcccacgac gtgcgggtgg cggtggtgca gtacagcggc acgggccagc agcgcccaga gcgggcgtcg ctgcagttcc tgcagaacta cacggccctg gccagtgccg tcgatgccat ggactttatc aacgacgcca ccgacgtcaa cgatgccctg ggctatgtga cccgcttcta ccgcgaggcc tcgtccggcg ctgccaagaa gaggctgctg ctcttctcag atggcaactc gcagggcgcc acgcccgctg ccatcgagaa ggccgtgcag gaagcccagc gggcaggcat cgagatcttc gtggtggtcg tgggccgcca ggtgaatgag ccccacatcc gcgtcctggt caccggcaag acggccgagt acgacgtggc ctacggcgag agccacctgt tccgtgtccc cagctaccag gccctgctcc gcggtgtctt ccaccagaca gtctccagga aggtggcgct gggctag. It is sometimes possible for the material contained within the vial of "COL6A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.