Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

COL23A1 cdna clone

COL23A1 cDNA Clone

Synonyms
COL23A1; COL23A1 cDNA Clone; COL23A1 cdna clone
Ordering
For Research Use Only!
Sequence
atggagtctcgctctggcatccaggctggagtgcggtgtcgcgatctcggctcactgcaacctccgcctctcgcgttaaagcagttctccagcctcagtctcccaagcagctgggattataggcgcctgccaccacgctgtggcttcctttttgaagtcagcgagaccacgaacccaccggcaggaaccaactccagacacactttgaccgtgaagttggacggactagcgaagatccggactgctcgggaagctccatccgaatgtgtctgccccccagggccccctggacggcgcggcaagcctgggagaagaggcgaccctggtcctccaggacccctgggtttggatggcaagcccggacttccaggcccgaaaggggaaaagggtgcaccaggagactttggcccccggggagaccaaggacaagatggagctgctgggcctccggggccccctggacctcctggggcccggggccctcctggcgacactgggaaagatggccccaggggagcacaaggcccagcgggccccaaaggagagcccggacaagacggcgagatgggcccaaagggacccccagggcccaagggtgagcctggagtacctggaaagaagggcgacgatgggacaccaagccagcctggaccaccagggcccaagggcgagccagggagcatggggcctcggggagagaacggtgtggacggtgccccaggaccgaagggggagcctggccaccgaggcacggatggagctgcagggccccggggtgacgtccgggatcctggcctcggctctgtctcctcatgctcccagaggctggcttcttcctccaaaaaaaatggatctgagcccccgcctggctgtgcagggtgccccaggcctcaagggcgagcagggagacacagtggtgatcgactatga
Sequence Length
930
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,672 Da
NCBI Official Full Name
Homo sapiens collagen, type XXIII, alpha 1, mRNA
NCBI Official Synonym Full Names
collagen type XXIII alpha 1 chain
NCBI Official Symbol
COL23A1
NCBI Protein Information
collagen alpha-1(XXIII) chain
UniProt Protein Name
Collagen alpha-1(XXIII) chain
Protein Family
UniProt Gene Name
COL23A1
UniProt Entry Name
CONA1_HUMAN

NCBI Description

COL23A1 is a member of the transmembrane collagens, a subfamily of the nonfibrillar collagens that contain a single pass hydrophobic transmembrane domain (Banyard et al., 2003 [PubMed 12644459]).[supplied by OMIM, Mar 2008]

Uniprot Description

COL23A1: 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 5q35.3

Cellular Component: endoplasmic reticulum lumen; plasma membrane

Molecular Function: protein binding

Research Articles on COL23A1

Similar Products

Product Notes

The COL23A1 col23a1 (Catalog #AAA1266737) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagtctc gctctggcat ccaggctgga gtgcggtgtc gcgatctcgg ctcactgcaa cctccgcctc tcgcgttaaa gcagttctcc agcctcagtc tcccaagcag ctgggattat aggcgcctgc caccacgctg tggcttcctt tttgaagtca gcgagaccac gaacccaccg gcaggaacca actccagaca cactttgacc gtgaagttgg acggactagc gaagatccgg actgctcggg aagctccatc cgaatgtgtc tgccccccag ggccccctgg acggcgcggc aagcctggga gaagaggcga ccctggtcct ccaggacccc tgggtttgga tggcaagccc ggacttccag gcccgaaagg ggaaaagggt gcaccaggag actttggccc ccggggagac caaggacaag atggagctgc tgggcctccg gggccccctg gacctcctgg ggcccggggc cctcctggcg acactgggaa agatggcccc aggggagcac aaggcccagc gggccccaaa ggagagcccg gacaagacgg cgagatgggc ccaaagggac ccccagggcc caagggtgag cctggagtac ctggaaagaa gggcgacgat gggacaccaa gccagcctgg accaccaggg cccaagggcg agccagggag catggggcct cggggagaga acggtgtgga cggtgcccca ggaccgaagg gggagcctgg ccaccgaggc acggatggag ctgcagggcc ccggggtgac gtccgggatc ctggcctcgg ctctgtctcc tcatgctccc agaggctggc ttcttcctcc aaaaaaaatg gatctgagcc cccgcctggc tgtgcagggt gccccaggcc tcaagggcga gcagggagac acagtggtga tcgactatga. It is sometimes possible for the material contained within the vial of "COL23A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.