Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

COG3 cdna clone

COG3 cDNA Clone

Gene Names
COG3; SEC34
Synonyms
COG3; COG3 cDNA Clone; COG3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggaggcggcgctgttgctgctgcctgaggcggcggcggagcgggacgctagggaaaagctggctctctgggatcggagaccggacacgacggcgccgctgaccgacaggcagacggactcggtattggagctgaaggcggcggcagagaacttgccggtgccagctgagcttccaattgaagacttgtgcagtttaacatcccagtcactgcccattgaactgacttcagtagtgcctgaatctacagaagacattctcttgaagggcttcacttccttaggaatggaagaagaaagaattgaaaccgcacagcagtttttctcatggtttgcaaagctgcaaactcagatggatcaagatgaaggaactaaatatagacagatgagggattacttgtctgggtttcaggagcagtgtgatgctatattgaatgatgtaaacagtgctcttcagcatctggagtctttgcagaaacagtatctttttgtgtccaataagacaggaaccctacatgaagcctgtgaacagctcctaaaagaacagtcggaacttgttgatctggctgaaaacattcaacaaaagctttcctattttaacgaattggaaactattaacacaaaattgaattcccctacattgtcggtgaatagtgacggatttatacctatgctggccaagttagatgattgtataacatatatctcatctcatcctaattttaaagattatcccatatatttgctgaagtttaaacagtgtctttctaaagctttgcacctcatgaagacatatactgtgaacacactacagaccctcacaagtcagttactgaaaagggatccttcatctgtacctaatgcagacaatgccttcacattattttatgtgaaatttcgagctgctgcccccaaagtcagaactcttattgaacaaatagaactgcggtctgaaaaaatacctgaataccaacaactgctaaatgatatccaccagtgttaccttgatcagcgggagctccttttgggccctagtattgcttgcactgttgcagagttaaccagccaaaataatagagatcactgtgccttggttcgtagtggctgtgccttcatggttcatgtctgccaggatgaacaccaactttacaatgaatttttcacaaaaccaacatcaaaattagatgagcttttggagaaactgtgtgtgtcattgtatgatgtcttcaggccattgatcattcatgttattcacttagagactctgtcggaactttgtgggattcttaaaaatgaagtgcttgaagatcatgtgcagaacaatggtaaatga
Sequence Length
1335
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
50,540 Da
NCBI Official Full Name
Homo sapiens component of oligomeric golgi complex 3, mRNA
NCBI Official Synonym Full Names
component of oligomeric golgi complex 3
NCBI Official Symbol
COG3
NCBI Official Synonym Symbols
SEC34
NCBI Protein Information
conserved oligomeric Golgi complex subunit 3
UniProt Protein Name
Conserved oligomeric Golgi complex subunit 3
UniProt Gene Name
COG3
UniProt Synonym Gene Names
SEC34; COG complex subunit 3
UniProt Entry Name
COG3_HUMAN

NCBI Description

This gene encodes a component of the conserved oligomeric Golgi (COG) complex which is composed of eight different subunits and is required for normal Golgi morphology and localization. Defects in the COG complex result in multiple deficiencies in protein glycosylation. The protein encoded by this gene is involved in ER-Golgi transport.[provided by RefSeq, Jun 2011]

Uniprot Description

COG3: Involved in ER-Golgi transport. Belongs to the COG3 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Vesicle

Chromosomal Location of Human Ortholog: 13q14.13

Cellular Component: cytoplasm; Golgi apparatus; Golgi membrane; Golgi transport complex; nucleoplasm; plasma membrane; trans-Golgi network membrane

Molecular Function: protein binding; protein transporter activity

Biological Process: ER to Golgi vesicle-mediated transport; Golgi organization and biogenesis; intra-Golgi vesicle-mediated transport; protein amino acid glycosylation; protein localization in organelle; protein stabilization; retrograde transport, vesicle recycling within Golgi; retrograde vesicle-mediated transport, Golgi to ER

Research Articles on COG3

Similar Products

Product Notes

The COG3 cog3 (Catalog #AAA1276148) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggagg cggcgctgtt gctgctgcct gaggcggcgg cggagcggga cgctagggaa aagctggctc tctgggatcg gagaccggac acgacggcgc cgctgaccga caggcagacg gactcggtat tggagctgaa ggcggcggca gagaacttgc cggtgccagc tgagcttcca attgaagact tgtgcagttt aacatcccag tcactgccca ttgaactgac ttcagtagtg cctgaatcta cagaagacat tctcttgaag ggcttcactt ccttaggaat ggaagaagaa agaattgaaa ccgcacagca gtttttctca tggtttgcaa agctgcaaac tcagatggat caagatgaag gaactaaata tagacagatg agggattact tgtctgggtt tcaggagcag tgtgatgcta tattgaatga tgtaaacagt gctcttcagc atctggagtc tttgcagaaa cagtatcttt ttgtgtccaa taagacagga accctacatg aagcctgtga acagctccta aaagaacagt cggaacttgt tgatctggct gaaaacattc aacaaaagct ttcctatttt aacgaattgg aaactattaa cacaaaattg aattccccta cattgtcggt gaatagtgac ggatttatac ctatgctggc caagttagat gattgtataa catatatctc atctcatcct aattttaaag attatcccat atatttgctg aagtttaaac agtgtctttc taaagctttg cacctcatga agacatatac tgtgaacaca ctacagaccc tcacaagtca gttactgaaa agggatcctt catctgtacc taatgcagac aatgccttca cattatttta tgtgaaattt cgagctgctg cccccaaagt cagaactctt attgaacaaa tagaactgcg gtctgaaaaa atacctgaat accaacaact gctaaatgat atccaccagt gttaccttga tcagcgggag ctccttttgg gccctagtat tgcttgcact gttgcagagt taaccagcca aaataataga gatcactgtg ccttggttcg tagtggctgt gccttcatgg ttcatgtctg ccaggatgaa caccaacttt acaatgaatt tttcacaaaa ccaacatcaa aattagatga gcttttggag aaactgtgtg tgtcattgta tgatgtcttc aggccattga tcattcatgt tattcactta gagactctgt cggaactttg tgggattctt aaaaatgaag tgcttgaaga tcatgtgcag aacaatggta aatga. It is sometimes possible for the material contained within the vial of "COG3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.