Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CNTD1 cdna clone

CNTD1 cDNA Clone

Gene Names
CNTD1; CNTD
Synonyms
CNTD1; CNTD1 cDNA Clone; CNTD1 cdna clone
Ordering
For Research Use Only!
Sequence
atggacggacccatgaggccacgatcggcctccctcgttgactttcagtttggagttgtcgccacagagacgattgaagacgccctgcttcacttggcccagcagaatgagcaagcagtgagggaggcttcggggcggctgggccgcttcagggagccccagatcgtggagtttgtttttctcctgtctgaacaatggtgtctggagaaatctgtgagctaccaggctgtagaaatcctagaaaggtttatggtaaaacaggcagagaacatctgcaggcaagccacaatccagccaagagataataagagagagtctcagaattggagggctctgaaacagcagcttgtcaacaagtttactctccgtcttgtgtcatgtgttcagctggccagcaaactttccttccgaaacaaaataatcagcaacattacagtcttgaatttcctccaggctctaggctatctacacactaaagaagaactgctggaatcagagcttgatgttttgaagtccttgaacttccgaattaatctgcccactcccctggcatatgtggagacgctcctagaggttttaggatacaatggctgtttggttccagccatgaggctgcatgcaacctgcctgacactgctcgacctggtctatcttctgcatgaacccatatatgagagcctgttgagggcttcaattgagaactccactcccagtcagctgcaaggggaaaagtttacttcagtgaaggaagacttcatgctgttggcagtaggaatcattgcagcaagtgctttcatccaaaaccatgagtgttggagccaggttgtggggcatttgcagagcatcactggtattgccttggcaagcattgctgagttctcttatgcaatcctgactcacggagtgggagccaacactccggggagacagcagtctattcctccccacctggcagccagagctctgaagactgttgcttcctctaacacatga
Sequence Length
993
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,813 Da
NCBI Official Full Name
Homo sapiens cyclin N-terminal domain containing 1, mRNA
NCBI Official Synonym Full Names
cyclin N-terminal domain containing 1
NCBI Official Symbol
CNTD1
NCBI Official Synonym Symbols
CNTD
NCBI Protein Information
cyclin N-terminal domain-containing protein 1
UniProt Protein Name
Cyclin N-terminal domain-containing protein 1
UniProt Gene Name
CNTD1
UniProt Synonym Gene Names
CNTD
UniProt Entry Name
CNTD1_HUMAN

Uniprot Description

CNTD1: 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 17q21.31

Similar Products

Product Notes

The CNTD1 cntd1 (Catalog #AAA1273756) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacggac ccatgaggcc acgatcggcc tccctcgttg actttcagtt tggagttgtc gccacagaga cgattgaaga cgccctgctt cacttggccc agcagaatga gcaagcagtg agggaggctt cggggcggct gggccgcttc agggagcccc agatcgtgga gtttgttttt ctcctgtctg aacaatggtg tctggagaaa tctgtgagct accaggctgt agaaatccta gaaaggttta tggtaaaaca ggcagagaac atctgcaggc aagccacaat ccagccaaga gataataaga gagagtctca gaattggagg gctctgaaac agcagcttgt caacaagttt actctccgtc ttgtgtcatg tgttcagctg gccagcaaac tttccttccg aaacaaaata atcagcaaca ttacagtctt gaatttcctc caggctctag gctatctaca cactaaagaa gaactgctgg aatcagagct tgatgttttg aagtccttga acttccgaat taatctgccc actcccctgg catatgtgga gacgctccta gaggttttag gatacaatgg ctgtttggtt ccagccatga ggctgcatgc aacctgcctg acactgctcg acctggtcta tcttctgcat gaacccatat atgagagcct gttgagggct tcaattgaga actccactcc cagtcagctg caaggggaaa agtttacttc agtgaaggaa gacttcatgc tgttggcagt aggaatcatt gcagcaagtg ctttcatcca aaaccatgag tgttggagcc aggttgtggg gcatttgcag agcatcactg gtattgcctt ggcaagcatt gctgagttct cttatgcaat cctgactcac ggagtgggag ccaacactcc ggggagacag cagtctattc ctccccacct ggcagccaga gctctgaaga ctgttgcttc ctctaacaca tga. It is sometimes possible for the material contained within the vial of "CNTD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.