Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CNOT6 cdna clone

CNOT6 cDNA Clone

Gene Names
CNOT6; CCR4; Ccr4a
Synonyms
CNOT6; CNOT6 cDNA Clone; CNOT6 cdna clone
Ordering
For Research Use Only!
Sequence
atgtgcatcatgacaatttccagtgaaggtgagctggagctggttggactaatgagactgaggaagcagcttttcctacgatctgcattatgtaatcacaggtccagagagctttatggaagcgggagaggaggagcacttactcatgttgtatttgttaatggaggatgtcatcttttcatagatgctggaactagagtgcacttgttagatgctaaaggtttgagctttacacaaaatgtcttcatctgtatttgttattgtctacaatatatttga
Sequence Length
279
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
63,307 Da
NCBI Official Full Name
Homo sapiens CCR4-NOT transcription complex, subunit 6, mRNA
NCBI Official Synonym Full Names
CCR4-NOT transcription complex subunit 6
NCBI Official Symbol
CNOT6
NCBI Official Synonym Symbols
CCR4; Ccr4a
NCBI Protein Information
CCR4-NOT transcription complex subunit 6
UniProt Protein Name
CCR4-NOT transcription complex subunit 6
UniProt Gene Name
CNOT6
UniProt Synonym Gene Names
CCR4; CCR4a; KIAA1194
UniProt Entry Name
CNOT6_HUMAN

NCBI Description

This gene encodes the catalytic component of the CCR4-NOT core transcriptional regulation complex. The encoded protein has a 3'-5' RNase activity and prefers polyadenylated substrates. The CCR4-NOT complex plays a role in many cellular processes, including miRNA-mediated repression, mRNA degradation, and transcriptional regulation. [provided by RefSeq, Dec 2014]

Uniprot Description

CNOT6: Poly(A) nuclease involved in mRNA decay mediated by the major-protein-coding determinant of instability (mCRD) of the FOS gene in the cytoplasm. Has 3'-5' RNase activity. The CCR4-NOT complex functions as general transcription regulation complex. In the presence of ZNF335, enhances ligand-dependent transcriptional activity of nuclear hormone receptors, including RARA. The increase of ligand-dependent ESR1-mediated transcription is much smaller, if any. Belongs to the CCR4/nocturin family.

Protein type: EC 3.1.13.4; Hydrolase

Chromosomal Location of Human Ortholog: 5q35.3

Cellular Component: CCR4-NOT complex; cytosol; membrane

Molecular Function: exoribonuclease activity; poly(A)-specific ribonuclease activity; protein binding

Biological Process: DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest; miRNA-mediated gene silencing; poly(A) tail shortening; positive regulation of cell proliferation

Research Articles on CNOT6

Similar Products

Product Notes

The CNOT6 cnot6 (Catalog #AAA1270955) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgcatca tgacaatttc cagtgaaggt gagctggagc tggttggact aatgagactg aggaagcagc ttttcctacg atctgcatta tgtaatcaca ggtccagaga gctttatgga agcgggagag gaggagcact tactcatgtt gtatttgtta atggaggatg tcatcttttc atagatgctg gaactagagt gcacttgtta gatgctaaag gtttgagctt tacacaaaat gtcttcatct gtatttgtta ttgtctacaa tatatttga. It is sometimes possible for the material contained within the vial of "CNOT6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.