Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CMTM7 cdna clone

CMTM7 cDNA Clone

Gene Names
CMTM7; CKLFSF7
Synonyms
CMTM7; CMTM7 cDNA Clone; CMTM7 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgcacggagccgggctcgtccgcaccacgtgcagcagcggcagcgcgctcggacccggggccggcgcggcccagcccagcgcgagccccttggaggggctgctggacctcagctacccccgcacccacgcggccctgctgaaagtggcgcaaatggtcaccctgctgattgccttcatctgtgtgcggagctccctgtggaccaactacagcgcctacagctactttgaagtggtcaccatttgcgacttgataatgatcctcgccttttacctggtccacctcttccgcttctaccgcgtgctcacctgtatcagctggcccctgtcggaacttctgcactatttaatcggtaccctgctcctcctcatcgcctccattgtggcagcttccaagagttacaaccagagcggactggtagccggagcgatctttggtttcatggccaccttcctctgcatggcaagcatatggctgtcctataagatctcgtgtgtaacccagtccacagatgcagccgtctga
Sequence Length
528
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,452 Da
NCBI Official Full Name
Homo sapiens CKLF-like MARVEL transmembrane domain containing 7, mRNA
NCBI Official Synonym Full Names
CKLF like MARVEL transmembrane domain containing 7
NCBI Official Symbol
CMTM7
NCBI Official Synonym Symbols
CKLFSF7
NCBI Protein Information
CKLF-like MARVEL transmembrane domain-containing protein 7
UniProt Protein Name
CKLF-like MARVEL transmembrane domain-containing protein 7
UniProt Gene Name
CMTM7
UniProt Synonym Gene Names
CKLFSF7
UniProt Entry Name
CKLF7_HUMAN

NCBI Description

This gene belongs to the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and transmembrane 4 superfamilies. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 3. This gene acts as a tumor suppressor that regulates G1/S transition in the cell cycle, and epidermal growth factor receptor/protein kinase B signaling during tumor pathogenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2016]

Uniprot Description

CMTM7: a member of the chemokine-like factor gene superfamily, a novel family that is similar to the chemokine and transmembrane 4 superfamilies. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 3. The protein encoded by this gene is highly expressed in leukocytes, but its exact function is unknown. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Protein type: Membrane protein, integral; Motility/polarity/chemotaxis; Cytokine; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 3p22.3

Cellular Component: membrane

Research Articles on CMTM7

Similar Products

Product Notes

The CMTM7 cmtm7 (Catalog #AAA1271627) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgcacg gagccgggct cgtccgcacc acgtgcagca gcggcagcgc gctcggaccc ggggccggcg cggcccagcc cagcgcgagc cccttggagg ggctgctgga cctcagctac ccccgcaccc acgcggccct gctgaaagtg gcgcaaatgg tcaccctgct gattgccttc atctgtgtgc ggagctccct gtggaccaac tacagcgcct acagctactt tgaagtggtc accatttgcg acttgataat gatcctcgcc ttttacctgg tccacctctt ccgcttctac cgcgtgctca cctgtatcag ctggcccctg tcggaacttc tgcactattt aatcggtacc ctgctcctcc tcatcgcctc cattgtggca gcttccaaga gttacaacca gagcggactg gtagccggag cgatctttgg tttcatggcc accttcctct gcatggcaag catatggctg tcctataaga tctcgtgtgt aacccagtcc acagatgcag ccgtctga. It is sometimes possible for the material contained within the vial of "CMTM7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.