Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CMPK1 cdna clone

CMPK1 cDNA Clone

Gene Names
CMPK1; CK; CMK; UMK; CMPK; UMPK; UMP-CMPK
Synonyms
CMPK1; CMPK1 cDNA Clone; CMPK1 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgagccgctgccgcagccggctgctccacgtcctgggccttagcttcctgctgcagacccgccggccgattctcctctgctctccacgtctcatgaagccgctggtcgtgttcgtcctcggcggccccggcgccggcaaggggacccagtgcgcccgcatcgtcgagaaatatggctacacacacctttctgcaggagagctgcttcgtgatgaaaggaagaacccagattcacagtatggtgaacttattgaaaagtacattaaagaaggaaagattgtaccagttgagataaccatcagtttattaaagagggaaatggatcagacaatggctgccaatgctcagaagaataaattcttgattgatgggtttccaagaaatcaagacaaccttcaaggatggaacaagaccatggatgggaaggcagatgtatctttcgttctcttttttgactgtaataatgagatttgtattgaacgatgtcttgagaggggaaagagtagtggtaggagtgatgacaacagagagagcttggaaaagagaattcagacctaccttcagtcaacaaagccaattattgacttatatgaagaaatggggaaagtcaagaaaatagatgcttctaaatctgttgatgaagtttttgatgaagttgtgcagatttttgacaaggaaggctaa
Sequence Length
687
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,548 Da
NCBI Official Full Name
Homo sapiens cytidine monophosphate (UMP-CMP) kinase 1, cytosolic, mRNA
NCBI Official Synonym Full Names
cytidine/uridine monophosphate kinase 1
NCBI Official Symbol
CMPK1
NCBI Official Synonym Symbols
CK; CMK; UMK; CMPK; UMPK; UMP-CMPK
NCBI Protein Information
UMP-CMP kinase
UniProt Protein Name
UMP-CMP kinase
UniProt Gene Name
CMPK1
UniProt Synonym Gene Names
CK; dCMP kinase; UMP/CMP kinase; UMP/CMPK
UniProt Entry Name
KCY_HUMAN

NCBI Description

This gene encodes one of the enzymes required for cellular nucleic acid biosynthesis. This enzyme catalyzes the transfer of a phosphate group from ATP to CMP, UMP, or dCMP, to form the corresponding diphosphate nucleotide. Alternate splicing results in both coding and non-coding transcript variants. [provided by RefSeq, Feb 2012]

Uniprot Description

CMPK: Catalyzes specific phosphoryl transfer from ATP to UMP and CMP. Belongs to the adenylate kinase family.

Protein type: Nucleotide Metabolism - pyrimidine; EC 2.7.4.14; Kinase, other; EC 2.7.4.6

Chromosomal Location of Human Ortholog: 1p32

Cellular Component: cytoplasm; cytosol

Molecular Function: nucleoside diphosphate kinase activity; nucleoside phosphate kinase activity; uridine kinase activity

Biological Process: nucleobase, nucleoside and nucleotide interconversion; nucleoside diphosphate phosphorylation; nucleoside triphosphate biosynthetic process; pyrimidine ribonucleotide biosynthetic process

Research Articles on CMPK1

Similar Products

Product Notes

The CMPK1 cmpk1 (Catalog #AAA1271078) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgagcc gctgccgcag ccggctgctc cacgtcctgg gccttagctt cctgctgcag acccgccggc cgattctcct ctgctctcca cgtctcatga agccgctggt cgtgttcgtc ctcggcggcc ccggcgccgg caaggggacc cagtgcgccc gcatcgtcga gaaatatggc tacacacacc tttctgcagg agagctgctt cgtgatgaaa ggaagaaccc agattcacag tatggtgaac ttattgaaaa gtacattaaa gaaggaaaga ttgtaccagt tgagataacc atcagtttat taaagaggga aatggatcag acaatggctg ccaatgctca gaagaataaa ttcttgattg atgggtttcc aagaaatcaa gacaaccttc aaggatggaa caagaccatg gatgggaagg cagatgtatc tttcgttctc ttttttgact gtaataatga gatttgtatt gaacgatgtc ttgagagggg aaagagtagt ggtaggagtg atgacaacag agagagcttg gaaaagagaa ttcagaccta ccttcagtca acaaagccaa ttattgactt atatgaagaa atggggaaag tcaagaaaat agatgcttct aaatctgttg atgaagtttt tgatgaagtt gtgcagattt ttgacaagga aggctaa. It is sometimes possible for the material contained within the vial of "CMPK1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.