Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CMC1 cdna clone

CMC1 cDNA Clone

Gene Names
CMC1; C3orf68
Synonyms
CMC1; CMC1 cDNA Clone; CMC1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgctcgaccccgcagaccagcatctcagacatgtcgaaaaagatgttttgatccctaaaataatgagagaaaaggccaaagagaggtgttctgaacaagttcaagattttaccaaatgttgcaagaactctggagttcttatggtagtaaaatgccggaaagaaaattctgcattgaaagaatgtctaactgcttactataatgatccagccttttatgaagaatgcaaaatggaatacctgaaggaaagggaagaattcagaaaaactggaattcctacaaagaaaaggctacagaagcttccaacaagcatgtag
Sequence Length
321
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,490 Da
NCBI Official Full Name
Homo sapiens COX assembly mitochondrial protein homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
C-X9-C motif containing 1
NCBI Official Symbol
CMC1
NCBI Official Synonym Symbols
C3orf68
NCBI Protein Information
COX assembly mitochondrial protein homolog
UniProt Protein Name
COX assembly mitochondrial protein homolog
UniProt Gene Name
CMC1
UniProt Synonym Gene Names
C3orf68; Cmc1p
UniProt Entry Name
COXM1_HUMAN

Uniprot Description

CMC1: Required for mitochondrial cytochrome c oxidase (COX) assembly and respiration. Binds copper. May be involved in copper trafficking and distribution to COX and SOD1. Belongs to the CMC family.

Chromosomal Location of Human Ortholog: 3p24.1

Cellular Component: mitochondrion

Research Articles on CMC1

Similar Products

Product Notes

The CMC1 cmc1 (Catalog #AAA1276936) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgctcg accccgcaga ccagcatctc agacatgtcg aaaaagatgt tttgatccct aaaataatga gagaaaaggc caaagagagg tgttctgaac aagttcaaga ttttaccaaa tgttgcaaga actctggagt tcttatggta gtaaaatgcc ggaaagaaaa ttctgcattg aaagaatgtc taactgctta ctataatgat ccagcctttt atgaagaatg caaaatggaa tacctgaagg aaagggaaga attcagaaaa actggaattc ctacaaagaa aaggctacag aagcttccaa caagcatgta g. It is sometimes possible for the material contained within the vial of "CMC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.