Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

CLN3 cdna clone

CLN3 cDNA Clone

Gene Names
CLN3; BTS; BTN1; JNCL
Synonyms
CLN3; CLN3 cDNA Clone; CLN3 cdna clone
Ordering
 
When autocomplete results are available use up and down arrows to review and enter to select. Touch device users, explore by touch or with swipe gestures.
For Research Use Only!
Sequence
atgggaggctgtgcaggctcgcggcggcgcttttcggattccgagggggaggagaccgtcccggagccccggctccctctgttggaccatcagggcgcgcattggaagaacgcggtgggcttctggctgctgggcctttgcaacaacttctcttatgtggtgatgctgagtgccgcccacgacatccttagccacaagaggacatcgggaaaccagagccatgtggacccaggcccaacgccgatcccccacaacagctcatcacgatttgactgcaactctgtctctacggctgctgtgctcctggcggacatcctccccacactcgtcatcaaattgttggctcctcttggccttcacctgctgccctacagcccccgggttctcgtcagtgggatttgtgctgctggaagcttcgtcctggttgccttttctcattctgtggggaccagcctgtgtggtgtggtcttcgctagcatctcatcaggccttggggaggtcaccttcctctccctcactgccttctaccccagggccgtgatctcctggtggtcctcagggactgggggagctgggctgctgggggccctgtcctacctgggcctcacccaggccggcctctcccctcagcagaccctgctgtccatgctgggtatccctgccctgctgctggccagctatttcttgttgctcacatctcctgaggcccaggaccctggaggggaagaagaagcagagagcgcagcccggcagcccctcataagaaccgaggccccggagtcgaagccaggctccagctccagcctctcccttcgggaaaggtggacagtgttcaagggtctgctgtggtacattgttcccttggtcgtagtttactttgccgagtatttcattaaccagggactttttgaactcctctttttctggaacacttccctgagtcacgctcagcaataccgctggtaccagatgctgtaccaggctggcgtctttgcctcccgctcttctctccgctgctgtcgcatccgtttcacctgggccctggccctgctgcagtgcctcaacctggtgttcctgctggcagacgtgtggttcggctttctgccaagcatctacctcgtcttcctgatcattctgtatgaggggctcctgggaggcgcagcctacgtgaacaccttccacaacatcgccctggagaccagtgatgagcaccgggagtttgcaatggcggccacctgcatctctgacacactggggatctccctgtcggggctcctggctttgcctctgcatgacttcctctgccagctctcctga
Sequence Length
1317
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,155 Da
NCBI Official Full Name
Homo sapiens ceroid-lipofuscinosis, neuronal 3, mRNA
NCBI Official Synonym Full Names
CLN3, battenin
NCBI Official Symbol
CLN3
NCBI Official Synonym Symbols
BTS; BTN1; JNCL
NCBI Protein Information
battenin
UniProt Protein Name
Battenin
Protein Family
UniProt Gene Name
CLN3
UniProt Synonym Gene Names
BTS
UniProt Entry Name
CLN3_HUMAN

NCBI Description

This gene encodes a protein that is involved in lysosomal function. Mutations in this, as well as other neuronal ceroid-lipofuscinosis (CLN) genes, cause neurodegenerative diseases commonly known as Batten disease or collectively known as neuronal ceroid lipofuscinoses (NCLs). Many alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

CLN3: Involved in microtubule-dependent, anterograde transport of late endosomes and lysosomes. Defects in CLN3 are the cause of neuronal ceroid lipofuscinosis type 3 (CLN3); also known as Batten disease. A form of neuronal ceroid lipofuscinosis. Neuronal ceroid lipofuscinoses are progressive neurodegenerative, lysosomal storage diseases characterized by intracellular accumulation of autofluorescent liposomal material, and clinically by seizures, dementia, visual loss, and/or cerebral atrophy. The hallmark of CLN3 is the ultrastructural pattern of lipopigment with a fingerprint profile, which can have 3 different appearances: pure within a lysosomal residual body; in conjunction with curvilinear or rectilinear profiles; and as a small component within large membrane-bound lysosomal vacuoles. The combination of fingerprint profiles within lysosomal vacuoles is a regular feature of blood lymphocytes from patients with CLN3. Belongs to the battenin family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Chaperone; Vesicle; Mitochondrial; Autophagy; Membrane protein, multi-pass; Apoptosis; Membrane protein, integral

Chromosomal Location of Human Ortholog: 16p12.1

Cellular Component: autophagic vacuole; caveola; cytoplasm; early endosome; endoplasmic reticulum; Golgi apparatus; Golgi membrane; Golgi stack; integral to endoplasmic reticulum membrane; integral to membrane; late endosome; lipid raft; lysosomal membrane; lysosome; mitochondrion; neuron projection; nucleus; plasma membrane; synaptic vesicle; trans-Golgi network

Molecular Function: protein binding; unfolded protein binding

Biological Process: amino acid metabolic process; amyloid precursor protein catabolic process; arginine transport; associative learning; ceramide metabolic process; cytosolic calcium ion homeostasis; galactosylceramide metabolic process; globoside metabolic process; glucosylceramide metabolic process; ionotropic glutamate receptor signaling pathway; lysosomal lumen acidification; lysosome organization and biogenesis; negative regulation of apoptosis; negative regulation of catalytic activity; negative regulation of macroautophagy; negative regulation of neuron apoptosis; negative regulation of proteolysis; neuromuscular process controlling balance; neurotransmitter metabolic process; protein processing; receptor-mediated endocytosis; regulation of action potential; sphingomyelin metabolic process; vacuolar transport; vesicle transport along microtubule

Disease: Ceroid Lipofuscinosis, Neuronal, 3

Research Articles on CLN3

Similar Products

Product Notes

The CLN3 cln3 (Catalog #AAA1277029) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggaggct gtgcaggctc gcggcggcgc ttttcggatt ccgaggggga ggagaccgtc ccggagcccc ggctccctct gttggaccat cagggcgcgc attggaagaa cgcggtgggc ttctggctgc tgggcctttg caacaacttc tcttatgtgg tgatgctgag tgccgcccac gacatcctta gccacaagag gacatcggga aaccagagcc atgtggaccc aggcccaacg ccgatccccc acaacagctc atcacgattt gactgcaact ctgtctctac ggctgctgtg ctcctggcgg acatcctccc cacactcgtc atcaaattgt tggctcctct tggccttcac ctgctgccct acagcccccg ggttctcgtc agtgggattt gtgctgctgg aagcttcgtc ctggttgcct tttctcattc tgtggggacc agcctgtgtg gtgtggtctt cgctagcatc tcatcaggcc ttggggaggt caccttcctc tccctcactg ccttctaccc cagggccgtg atctcctggt ggtcctcagg gactggggga gctgggctgc tgggggccct gtcctacctg ggcctcaccc aggccggcct ctcccctcag cagaccctgc tgtccatgct gggtatccct gccctgctgc tggccagcta tttcttgttg ctcacatctc ctgaggccca ggaccctgga ggggaagaag aagcagagag cgcagcccgg cagcccctca taagaaccga ggccccggag tcgaagccag gctccagctc cagcctctcc cttcgggaaa ggtggacagt gttcaagggt ctgctgtggt acattgttcc cttggtcgta gtttactttg ccgagtattt cattaaccag ggactttttg aactcctctt tttctggaac acttccctga gtcacgctca gcaataccgc tggtaccaga tgctgtacca ggctggcgtc tttgcctccc gctcttctct ccgctgctgt cgcatccgtt tcacctgggc cctggccctg ctgcagtgcc tcaacctggt gttcctgctg gcagacgtgt ggttcggctt tctgccaagc atctacctcg tcttcctgat cattctgtat gaggggctcc tgggaggcgc agcctacgtg aacaccttcc acaacatcgc cctggagacc agtgatgagc accgggagtt tgcaatggcg gccacctgca tctctgacac actggggatc tccctgtcgg ggctcctggc tttgcctctg catgacttcc tctgccagct ctcctga. It is sometimes possible for the material contained within the vial of "CLN3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.
Looking for a specific manual?
Request a Manual