Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CLEC3A cdna clone

CLEC3A cDNA Clone

Gene Names
CLEC3A; CLECSF1
Synonyms
CLEC3A; CLEC3A cDNA Clone; CLEC3A cdna clone
Ordering
For Research Use Only!
Sequence
ATGGCAAAGAATGGACTTGTAATTTGCATCCTGGTGATCACCTTACTCCTGGACCAGACCACCAGCCACACATCCAGATTAAAAGCCAGGAAGCACAGCAAACGTCGAGTGAGAGACAAGGATGGAGATCTGAAGACTCAAATTGAAAAGCTCTGGACAGAAGTCAATGCCTTGAAGGAAATTCAAGCCCTGCAGACAGTCTGTCTCCGAGGCACTAAAGTTCACAAGAAATGCTACCTTGCTTCAGAAGGTTTGAAGCATTTCCATGAGGCCAATGAAGACTGCATTTCCAAAGGAGGAATCCTGGTTATCCCCAGGAACTCCGACGAAATCAACGCCCTCCAAGACTATGGTAAAAGGAGCCTGCCAGGTGTCAATGACTTTTGGCTGGGCATCAATGACATGGTCACGGAAGGCAAGTTTGTTGACGTCAACGGAATCGCTATCTCCTTCCTCAACTGGGACCGTGCACAGCCTAACGGTGGCAAGCGAGAAAACTGTGTCCTGTTCTCCCAATCAGCTCAGGGCAAGTGGAGTGATGAGGCCTGTCGCAGCAGCAAGAGATACATATGCGAGTTCACCATCCCTCAATAG
Sequence Length
594
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,233 Da
NCBI Official Full Name
Homo sapiens C-type lectin domain family 3, member A, mRNA
NCBI Official Synonym Full Names
C-type lectin domain family 3 member A
NCBI Official Symbol
CLEC3A
NCBI Official Synonym Symbols
CLECSF1
NCBI Protein Information
C-type lectin domain family 3 member A
UniProt Protein Name
C-type lectin domain family 3 member A
UniProt Gene Name
CLEC3A
UniProt Synonym Gene Names
CLECSF1
UniProt Entry Name
CLC3A_HUMAN

Uniprot Description

CLEC3A: Promotes cell adhesion to laminin-332 and fibronectin.

Protein type: Secreted, signal peptide; Extracellular matrix; Secreted

Chromosomal Location of Human Ortholog: 16q23

Biological Process: skeletal development

Research Articles on CLEC3A

Similar Products

Product Notes

The CLEC3A clec3a (Catalog #AAA1268374) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGGCAAAGA ATGGACTTGT AATTTGCATC CTGGTGATCA CCTTACTCCT GGACCAGACC ACCAGCCACA CATCCAGATT AAAAGCCAGG AAGCACAGCA AACGTCGAGT GAGAGACAAG GATGGAGATC TGAAGACTCA AATTGAAAAG CTCTGGACAG AAGTCAATGC CTTGAAGGAA ATTCAAGCCC TGCAGACAGT CTGTCTCCGA GGCACTAAAG TTCACAAGAA ATGCTACCTT GCTTCAGAAG GTTTGAAGCA TTTCCATGAG GCCAATGAAG ACTGCATTTC CAAAGGAGGA ATCCTGGTTA TCCCCAGGAA CTCCGACGAA ATCAACGCCC TCCAAGACTA TGGTAAAAGG AGCCTGCCAG GTGTCAATGA CTTTTGGCTG GGCATCAATG ACATGGTCAC GGAAGGCAAG TTTGTTGACG TCAACGGAAT CGCTATCTCC TTCCTCAACT GGGACCGTGC ACAGCCTAAC GGTGGCAAGC GAGAAAACTG TGTCCTGTTC TCCCAATCAG CTCAGGGCAA GTGGAGTGAT GAGGCCTGTC GCAGCAGCAA GAGATACATA TGCGAGTTCA CCATCCCTCA ATAG. It is sometimes possible for the material contained within the vial of "CLEC3A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.