Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CLEC12A cdna clone

CLEC12A cDNA Clone

Gene Names
CLEC12A; CLL1; MICL; CD371; CLL-1; DCAL-2
Synonyms
CLEC12A; CLEC12A cDNA Clone; CLEC12A cdna clone
Ordering
For Research Use Only!
Sequence
atgtctgaagaagttacttatgcagatcttcaattccagaactccagtgagatggaaaaaatcccagaaattggcaaatttggggaaaaagcacctccagctccctctcatgtatggcgtccagcagccttgtttctgactcttctgtgccttctgttgctcattggattgggagtcttggcaagcatgtttcacgtaactttgaagatagaaatgaaaaaaatgaacaaactacaaaacatcagtgaagagctccagagaaatatttctctacaactgatgagtaacatgaatatctccaacaagatcaggaacctctccaccacactgcaaacaatagccaccaaattatgtcgtgagctatatagcaaagaacaagagcacaaatgtaagccttgtccaaggagatggatttggcataaggacagctgttatttcctaagtgatgatgtccaaacatggcaggagagtaaaatggcctgtgctgctcagaatgccagcctgttgaagataaacaacaaaaatgcattggaatttataaaatcccagagtagatcatatgactattggctgggattatctcctgaagaagattccactcgtggtatgagagtggataatataatcaactcctctgcctga
Sequence Length
642
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,449 Da
NCBI Official Full Name
Homo sapiens C-type lectin domain family 12, member A, mRNA
NCBI Official Synonym Full Names
C-type lectin domain family 12 member A
NCBI Official Symbol
CLEC12A
NCBI Official Synonym Symbols
CLL1; MICL; CD371; CLL-1; DCAL-2
NCBI Protein Information
C-type lectin domain family 12 member A
UniProt Protein Name
C-type lectin domain family 12 member A
UniProt Gene Name
CLEC12A
UniProt Synonym Gene Names
CLL1; DCAL2; MICL; CLL-1; DCAL-2; MICL
UniProt Entry Name
CL12A_HUMAN

NCBI Description

This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signaling, glycoprotein turnover, and roles in inflammation and immune response. The protein encoded by this gene is a negative regulator of granulocyte and monocyte function. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. This gene is closely linked to other CTL/CTLD superfamily members in the natural killer gene complex region on chromosome 12p13. [provided by RefSeq, May 2011]

Uniprot Description

CLEC12A: Cell surface receptor that modulates signaling cascades and mediates tyrosine phosphorylation of target MAP kinases. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 12p13.2

Research Articles on CLEC12A

Similar Products

Product Notes

The CLEC12A clec12a (Catalog #AAA1270803) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgaag aagttactta tgcagatctt caattccaga actccagtga gatggaaaaa atcccagaaa ttggcaaatt tggggaaaaa gcacctccag ctccctctca tgtatggcgt ccagcagcct tgtttctgac tcttctgtgc cttctgttgc tcattggatt gggagtcttg gcaagcatgt ttcacgtaac tttgaagata gaaatgaaaa aaatgaacaa actacaaaac atcagtgaag agctccagag aaatatttct ctacaactga tgagtaacat gaatatctcc aacaagatca ggaacctctc caccacactg caaacaatag ccaccaaatt atgtcgtgag ctatatagca aagaacaaga gcacaaatgt aagccttgtc caaggagatg gatttggcat aaggacagct gttatttcct aagtgatgat gtccaaacat ggcaggagag taaaatggcc tgtgctgctc agaatgccag cctgttgaag ataaacaaca aaaatgcatt ggaatttata aaatcccaga gtagatcata tgactattgg ctgggattat ctcctgaaga agattccact cgtggtatga gagtggataa tataatcaac tcctctgcct ga. It is sometimes possible for the material contained within the vial of "CLEC12A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.