Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CLEC10A cdna clone

CLEC10A cDNA Clone

Gene Names
CLEC10A; HML; MGL; HML2; CD301; CLECSF13; CLECSF14
Synonyms
CLEC10A; CLEC10A cDNA Clone; CLEC10A cdna clone
Ordering
For Research Use Only!
Sequence
atgacaaggacgtatgaaaacttccagtacttggagaataaggtgaaagtccaggggtttaaaaatgggccacttcctctccagtccctcctgcagcgtctccgctctgggccctgccatctcctgctgtccctgggcctcggcctgctgctgctggtcatcatctgtgtggttggattccaaaattccaaatttcagagggacctggtgaccctgagaacagattttagcaacttcacctcaaacactgtggcggagatccaggcactgacttcccagggcagcagcttggaagaaacgatagcatctctgaaagctgaggtggagggtttcaggcaggaacggcaggcagttcattctgaaatgctcctgcgagtccagcagctggtgcaagacctgaagaaactgacctgccaggtggctactctcaacaacaatgcctccactgaagggacctgctgccccgtcaactgggtggagcaccaagacagctgctactggttctctcactctgggatgtcctgggccgaggctgagaagtactgccagctgaagaacgcccacctggtggtcatcaactccagggaggagcaggtgagggcttctggtactcagttcctaagacatgtcccatttagggaaatggttcttaagcttggccgcacattggaatcatctgggagcttccagaatgactgtcatctgtgccacaccctcagagatttaataggcctgagcatccagagaaacatctccaaactcctcagttga
Sequence Length
771
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,877 Da
NCBI Official Full Name
Homo sapiens C-type lectin domain family 10, member A, mRNA
NCBI Official Synonym Full Names
C-type lectin domain family 10 member A
NCBI Official Symbol
CLEC10A
NCBI Official Synonym Symbols
HML; MGL; HML2; CD301; CLECSF13; CLECSF14
NCBI Protein Information
C-type lectin domain family 10 member A
UniProt Protein Name
C-type lectin domain family 10 member A
UniProt Gene Name
CLEC10A
UniProt Synonym Gene Names
CLECSF13; CLECSF14; HML
UniProt Entry Name
CLC10_HUMAN

NCBI Description

This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may function as a cell surface antigen. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

CLEC10A: Probable role in regulating adaptive and innate immune responses. Binds in a calcium-dependent manner to terminal galactose and N-acetylgalactosamine units, linked to serine or threonine. These sugar moieties are known as Tn-Ag and are expressed in a variety of carcinoma cells. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 17p13.1

Cellular Component: plasma membrane

Research Articles on CLEC10A

Similar Products

Product Notes

The CLEC10A clec10a (Catalog #AAA1275698) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacaagga cgtatgaaaa cttccagtac ttggagaata aggtgaaagt ccaggggttt aaaaatgggc cacttcctct ccagtccctc ctgcagcgtc tccgctctgg gccctgccat ctcctgctgt ccctgggcct cggcctgctg ctgctggtca tcatctgtgt ggttggattc caaaattcca aatttcagag ggacctggtg accctgagaa cagattttag caacttcacc tcaaacactg tggcggagat ccaggcactg acttcccagg gcagcagctt ggaagaaacg atagcatctc tgaaagctga ggtggagggt ttcaggcagg aacggcaggc agttcattct gaaatgctcc tgcgagtcca gcagctggtg caagacctga agaaactgac ctgccaggtg gctactctca acaacaatgc ctccactgaa gggacctgct gccccgtcaa ctgggtggag caccaagaca gctgctactg gttctctcac tctgggatgt cctgggccga ggctgagaag tactgccagc tgaagaacgc ccacctggtg gtcatcaact ccagggagga gcaggtgagg gcttctggta ctcagttcct aagacatgtc ccatttaggg aaatggttct taagcttggc cgcacattgg aatcatctgg gagcttccag aatgactgtc atctgtgcca caccctcaga gatttaatag gcctgagcat ccagagaaac atctccaaac tcctcagttg a. It is sometimes possible for the material contained within the vial of "CLEC10A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.