CIDEB cdna clone
CIDEB cDNA Clone
Synonyms
CIDEB; CIDEB cDNA Clone; CIDEB cdna clone
Sequence
atggagtacctctcagctctgaaccccagtgacttactcaggtcagtatctaatataagctcggagtttggacggagggtctggacctcagctccaccaccccagcgacctttccgtgtctgtgatcacaagcggaccatccggaaaggcctgacagctgccacccgccaggagctgctagccaaagcattggagaccctactgctgaatggagtgctaaccctggtgctagaggaggatggaactgcagtggacagtgaggacttcttccagctgctggaggatgacacgtgcctgatggtgttgcagtctggtcagagctggagccctacaaggagtggagtgctgtcatatggcctgggacgggagaggcccaagcacagcaaggacatcgcccgattcacctttgacgtgtacaagcaaaaccctcgagacctctttggcagcctgaatgtcaaagccacattctacgggctctactctatgagttgtgactttcaaggacttggcccaaagaaagtactcagggagctccttcgttggacctccacactgctgcaaggcctgggccatatgttgctgggaatttcctccacccttcgtcatgcagtggagggggctgagcagtggcagcagaagggccgcctccattcctactaa
Sequence Length
660
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
24,678 Da
NCBI Official Full Name
Homo sapiens cell death-inducing DFFA-like effector b, mRNA
NCBI Official Synonym Full Names
cell death-inducing DFFA-like effector b
NCBI Official Symbol
CIDEB
NCBI Protein Information
cell death activator CIDE-B
UniProt Protein Name
Cell death activator CIDE-B
Protein Family
UniProt Gene Name
CIDEB
UniProt Entry Name
CIDEB_HUMAN
Uniprot Description
CIDEB: Activates apoptosis.
Protein type: Apoptosis
Chromosomal Location of Human Ortholog: 14q12
Cellular Component: cytosol; lipid particle; perinuclear region of cytoplasm
Molecular Function: identical protein binding; protein binding
Biological Process: apoptosis; DNA damage response, signal transduction resulting in induction of apoptosis
Research Articles on CIDEB
Similar Products
Product Notes
The CIDEB cideb (Catalog #AAA1275205) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagtacc tctcagctct gaaccccagt gacttactca ggtcagtatc taatataagc tcggagtttg gacggagggt ctggacctca gctccaccac cccagcgacc tttccgtgtc tgtgatcaca agcggaccat ccggaaaggc ctgacagctg ccacccgcca ggagctgcta gccaaagcat tggagaccct actgctgaat ggagtgctaa ccctggtgct agaggaggat ggaactgcag tggacagtga ggacttcttc cagctgctgg aggatgacac gtgcctgatg gtgttgcagt ctggtcagag ctggagccct acaaggagtg gagtgctgtc atatggcctg ggacgggaga ggcccaagca cagcaaggac atcgcccgat tcacctttga cgtgtacaag caaaaccctc gagacctctt tggcagcctg aatgtcaaag ccacattcta cgggctctac tctatgagtt gtgactttca aggacttggc ccaaagaaag tactcaggga gctccttcgt tggacctcca cactgctgca aggcctgggc catatgttgc tgggaatttc ctccaccctt cgtcatgcag tggagggggc tgagcagtgg cagcagaagg gccgcctcca ttcctactaa. It is sometimes possible for the material contained within the vial of "CIDEB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
