CIAO1 cdna clone
CIAO1 cDNA Clone
Gene Names
CIAO1; CIA1; WDR39
Synonyms
CIAO1; CIAO1 cDNA Clone; CIAO1 cdna clone
Sequence
atgaaggactcgctggtgctgctgggccgtgtcccggcgcacccggactcccgctgctggttcctggcctggaaccccgcggggaccctgctggcctcgtgcggcggcgaccggagaatccgcatctggggcacggagggtgacagctggatctgcaagtctgtcctttctgaaggccaccagcgcaccgtgcggaaggtagcctggtccccctgcggtaattacctggcctctgccagctttgatgctaccacttgcatttggaagaagaaccaggatgactttgagtgtgtaaccactctcgagggccatgaaaatgaggtcaagtcagtggcttgggccccatctggcaacctcctggccacttgcagccgagataagagcgtttgggtctgggaagttgatgaagaggatgagtatgaatgtgtcagtgttctcaactcccacacacaggatgtcaagcatgtggtttggcacccaagtcaggagctcttagcttctgccagctatgatgacacagtgaagctgtaccgggaggaagaggatgactgggtatgctgtgccacccttgagggccatgaatccactgtgtggagcttggcctttgacccgagtggccagcgcctggcgtcttgtagtgatgaccgtactgtgcgtatctggcgtcagtatctaccaggcaatgaacaaggggtggcatgcagcggctctgaccccagttggaaatgtatctgtactttgtccggcttccactcaaggaccatttatgacattgcttggtgtcagctgacaggggctctggccacagcttgtggggatgacgcgatccgcgtgtttcaggaggatcccaactcggatccacagcagcccaccttctccctgacagcccacttgcatcaggcccattcccaggatgtcaactgtgtggcctggaaccccaaggagccagggctactggcctcctgcagtgatgatggggaggtggccttctggaagtatcagcggcctgaaggcctctga
Sequence Length
1020
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
37,840 Da
NCBI Official Full Name
Homo sapiens cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
cytosolic iron-sulfur assembly component 1
NCBI Official Symbol
CIAO1
NCBI Official Synonym Symbols
CIA1; WDR39
NCBI Protein Information
probable cytosolic iron-sulfur protein assembly protein CIAO1
UniProt Protein Name
Probable cytosolic iron-sulfur protein assembly protein CIAO1
Protein Family
UniProt Gene Name
CIAO1
UniProt Entry Name
CIAO1_HUMAN
Uniprot Description
CIAO1: Key component of the cytosolic iron-sulfur protein assembly (CIA) complex, a multiprotein complex that mediates the incorporation of iron-sulfur cluster into extramitochondrial Fe/S proteins. Seems to specifically modulate the transactivation activity of WT1. As part of the mitotic spindle-associated MMXD complex it may play a role in chromosome segregation. Belongs to the WD repeat CIA1 family.
Chromosomal Location of Human Ortholog: 2q11.2
Molecular Function: protein binding
Biological Process: iron-sulfur cluster assembly; positive regulation of cell proliferation; regulation of transcription from RNA polymerase II promoter
Research Articles on CIAO1
Similar Products
Product Notes
The CIAO1 ciao1 (Catalog #AAA1275792) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaggact cgctggtgct gctgggccgt gtcccggcgc acccggactc ccgctgctgg ttcctggcct ggaaccccgc ggggaccctg ctggcctcgt gcggcggcga ccggagaatc cgcatctggg gcacggaggg tgacagctgg atctgcaagt ctgtcctttc tgaaggccac cagcgcaccg tgcggaaggt agcctggtcc ccctgcggta attacctggc ctctgccagc tttgatgcta ccacttgcat ttggaagaag aaccaggatg actttgagtg tgtaaccact ctcgagggcc atgaaaatga ggtcaagtca gtggcttggg ccccatctgg caacctcctg gccacttgca gccgagataa gagcgtttgg gtctgggaag ttgatgaaga ggatgagtat gaatgtgtca gtgttctcaa ctcccacaca caggatgtca agcatgtggt ttggcaccca agtcaggagc tcttagcttc tgccagctat gatgacacag tgaagctgta ccgggaggaa gaggatgact gggtatgctg tgccaccctt gagggccatg aatccactgt gtggagcttg gcctttgacc cgagtggcca gcgcctggcg tcttgtagtg atgaccgtac tgtgcgtatc tggcgtcagt atctaccagg caatgaacaa ggggtggcat gcagcggctc tgaccccagt tggaaatgta tctgtacttt gtccggcttc cactcaagga ccatttatga cattgcttgg tgtcagctga caggggctct ggccacagct tgtggggatg acgcgatccg cgtgtttcag gaggatccca actcggatcc acagcagccc accttctccc tgacagccca cttgcatcag gcccattccc aggatgtcaa ctgtgtggcc tggaacccca aggagccagg gctactggcc tcctgcagtg atgatgggga ggtggccttc tggaagtatc agcggcctga aggcctctga. It is sometimes possible for the material contained within the vial of "CIAO1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
