CHTF8 cdna clone

CHTF8

Cat. Num. AAA200891

• Gene Names: CHTF8; CTF8; DERPC
• Synonyms: CHTF8; CTF8; DERPC; CHTF8 cdna clone

• Form/Format: Lyophilized
• Sequence: Nucleotide Sequence: ATGGTGCAAATTGTTATTTCCAGTGCGAGGGCTGGAGGCCTGGCAGAATGGGTGCTGATGGAGCTACAGGGGGAGATCGAGGCTCGCTACAGCACTGGATTAGCTGGAAACCTCCTGGGAGACCTACATTACACCACTGAGGGAATCCCTGTGCTGATCGTGGGGCATCATATCCTGTATGGGAAAATCATCCACCTGGAGAAACCTTTTGCAGTCCTTGTCAAACACACTCCTGGGGATCAGGACTGTGATGAGCTTGGCCGCGAGACTGGCACCCGGTACCTGGTGACAGCACTCATCAAAGACAAGATCCTTTTCAAAACCCGCCCCAAGCCCATTATCACCAGCGTCCCCAAGAAAGTATGA; ; Translation Sequence: MVQIVISSAR AGGLAEWVLM ELQGEIEARY STGLAGNLLG DLHYTTEGIP VLIVGHHILYGKIIHLEKPF AVLVKHTPGD QDCDELGRET GTRYLVTALI KDKILFKTRP KPIITSVPKKV
• Sequence Length: 121

• Species: Human
• Chromosome Location: 16q22.1
• OMIM Reference Number: 613202
• cDNA Size: 366bp
• Vector Description: This shuttle vector contains the complete ORF. It is inseted BamH I to Xho I. The gene insert contains multiple cloning sites which can be used to easily cut and transfer the gene and recombination site into your expression vector.
• Vector: (puc19-derived cloning vector)
• Preparation Before Usage: 1. Centrifuge at 7000rpm for 1 minute. 2. Carefully open the vial and add 100ul of sterile water to dissolve the DNA. Each tube contains approximately 10ug of lyophilized plasmid.
• Preparation and Storage: Store the plasmid at -20 degree C.

Related Product Information for CHTF8 cdna clone

CTF8 is a member of the DERPC family and is encoded by a gene that maps to human chromosome 16q22. 1. It exists as two alternatively spliced isoforms.

NCBI and Uniprot Product Information

• NCBI GI #: 94421448
• NCBI GeneID: 54921
• NCBI Accession #: NP_001035236.1
• NCBI GenBank Nucleotide #: NM_001040146.3
• UniProt Accession #: P0CG13
• NCBI Official Full Name: chromosome transmission fidelity protein 8 homolog
• NCBI Official Synonym Full Names: chromosome transmission fidelity factor 8
• NCBI Official Symbol: CHTF8
• NCBI Official Synonym Symbols: CTF8; DERPC
• NCBI Protein Information: chromosome transmission fidelity protein 8 homolog
• UniProt Protein Name: Chromosome transmission fidelity protein 8 homolog
• Protein Family: Chromosome transmission fidelity protein
• UniProt Gene Name: CHTF8
• UniProt Synonym Gene Names: CTF8; hCTF8

NCBI Description

This gene encodes a short protein that forms part of the Ctf18 replication factor C (RFC) complex that occurs in both yeast and mammals. The heteroheptameric RFC complex plays a role in sister chromatid cohesion and may load the replication clamp PCNA (proliferating cell nuclear antigen) onto DNA during DNA replication and repair. This gene is ubiquitously expressed and has been shown to have reduced expression in renal and prostate tumors. Alternatively spliced transcript variants have been described. This gene has a pseudogene on chromosome X. [provided by RefSeq, Oct 2018]

Uniprot Description

Chromosome cohesion factor involved in sister chromatid cohesion and fidelity of chromosome transmission. Component of one of the cell nuclear antigen loader complexes, CTF18-replication factor C (CTF18-RFC), which consists of CTF18, CTF8, DCC1, RFC2, RFC3, RFC4 and RFC5. The CTF18-RFC complex binds to single-stranded and primed DNAs and has weak ATPase activity that is stimulated the presence of primed DNA, replication protein A (RPA) and proliferating cell nuclear antigen (PCNA). The CTF18-RFC complex catalyzes the ATP-dependent loading of PCNA onto primed and gapped DNA. It also interacts with and stimulates POLH, which is suggestive of a protein network that coordinates DNA repair, recombination and chromosome cohesion reactions with replication fork progression.