Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CHST4 cdna clone

CHST4 cDNA Clone

Gene Names
CHST4; GST3; LSST; GlcNAc6ST2; HECGLCNAC6ST
Synonyms
CHST4; CHST4 cDNA Clone; CHST4 cdna clone
Ordering
For Research Use Only!
Sequence
atggccatcttggctctattcttccacatgtacagccacaacatcagctccctgtctatgaaggcacagcccgagcgcatgcacgtgctggttctgtcttcctggcgctctggctcttcttttgtggggcagctttttgggcagcacccagatgttttctacctgatggagcccgcctggcacgtgtggatgaccttcaagcagagcaccgcctggatgctgcacatggctgtgcgggatctgatacgggccgtcttcttgtgcgacatgagcgtctttgatgcctacatggaacctggtccccggagacagtccagcctctttcagtgggagaacagccgggccctgtgttctgcacctgcctgtgacatcatcccacaagatgaaatcatcccccgggctcactgcaggctcctgtgcagtcaacagccctttgaggtggtggagaaggcctgccgctcctacagccacgtggtgctcaaggaggtgcgcttcttcaacctgcagtccctctacccgctgctgaaagacccctccctcaacctgcatatcgtgcacctggtccgggacccccgggccgtgttccgttcccgagaacgcacaaagggagatctcatgattgacagtcgcattgtgatggggcagcatgagcaaaaactcaagaaggaggaccaaccctactatgtgatgcaggtcatctgccaaagccagctggagatctacaagaccatccagtccttgcccaaggccctgcaggaacgctacctgcttgtgcgctatgaggacctggctcgagcccctgtggcccagacttcccgaatgtatgaattcgtgggattggaattcttgccccatcttcagacctgggtgcataacatcacccgaggcaagggcatgggtgaccacgctttccacacaaatgccagggatgcccttaatgtctcccaggcttggcgctggtctttgccctatgaaaaggtttctcgacttcagaaagcctgtggcgatgccatgaatttgctgggctaccgccacgtcagatctgaacaagaacagagaaacctgttgctggatcttctgtctacctggactgtccctgagcaaatccactaa
Sequence Length
1113
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,134 Da
NCBI Official Full Name
Homo sapiens carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4, mRNA
NCBI Official Synonym Full Names
carbohydrate sulfotransferase 4
NCBI Official Symbol
CHST4
NCBI Official Synonym Symbols
GST3; LSST; GlcNAc6ST2; HECGLCNAC6ST
NCBI Protein Information
carbohydrate sulfotransferase 4
UniProt Protein Name
Carbohydrate sulfotransferase 4
UniProt Gene Name
CHST4
UniProt Synonym Gene Names
GST-3; HEC-GlcNAc6ST; LSST; GlcNAc6ST-2; Gn6st-2
UniProt Entry Name
CHST4_HUMAN

NCBI Description

This gene encodes an N-acetylglucosamine 6-O sulfotransferase. The encoded enzyme transfers sulfate from 3'phosphoadenosine 5'phospho-sulfate to the 6-hydroxyl group of N-acetylglucosamine on glycoproteins. This protein is localized to the Golgi and is involved in the modification of glycan structures on ligands of the lymphocyte homing receptor L-selectin. Alternate splicing in the 5' UTR results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2009]

Uniprot Description

CHST4: Sulfotransferase that utilizes 3'-phospho-5'-adenylyl sulfate (PAPS) as sulfonate donor to catalyze the transfer of sulfate to position 6 of non-reducing N-acetylglucosamine (GlcNAc) residues within mucin-associated glycans that ultimately serve as SELL ligands. SELL ligands are present in high endothelial cells (HEVs) and play a central role in lymphocyte homing at sites of inflammation. Participates in biosynthesis of the SELL ligand sialyl 6-sulfo Lewis X on receptors SPN/CD43, GLYCAM1 and MADCAM1. Also involved in biosynthesis of SELL ligand recognized by MECA-79 antibody. Plays a central role in lymphocyte trafficking during chronic inflammation. Has a catalytic preference for core 2- branched mucin-type O-glycans. Can use GlcNAcbeta1-6[Galbeta1- 3]GalNAc-pNP (core 2), GlcNAcbeta1-6ManOMe and GlcNAcbeta1-2Man oligosaccharide structures as acceptors. Has also activity toward core 3 of GlcNAcbeta1-3GalNAc-pNP. Its substrate specificity may be influenced by its subcellular location. Belongs to the sulfotransferase 1 family. Gal/GlcNAc/GalNAc subfamily.

Protein type: Membrane protein, integral; Transferase; EC 2.8.2.-; Glycan Metabolism - keratan sulfate biosynthesis

Chromosomal Location of Human Ortholog: 16q22.2

Cellular Component: Golgi membrane; integral to membrane; trans-Golgi network

Molecular Function: N-acetylglucosamine 6-O-sulfotransferase activity; sulfotransferase activity

Biological Process: cell adhesion; cell motility; cell-cell signaling; immune response; N-acetylglucosamine metabolic process; O-glycan processing; protein amino acid sulfation; sulfur metabolic process

Research Articles on CHST4

Similar Products

Product Notes

The CHST4 chst4 (Catalog #AAA1278682) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccatct tggctctatt cttccacatg tacagccaca acatcagctc cctgtctatg aaggcacagc ccgagcgcat gcacgtgctg gttctgtctt cctggcgctc tggctcttct tttgtggggc agctttttgg gcagcaccca gatgttttct acctgatgga gcccgcctgg cacgtgtgga tgaccttcaa gcagagcacc gcctggatgc tgcacatggc tgtgcgggat ctgatacggg ccgtcttctt gtgcgacatg agcgtctttg atgcctacat ggaacctggt ccccggagac agtccagcct ctttcagtgg gagaacagcc gggccctgtg ttctgcacct gcctgtgaca tcatcccaca agatgaaatc atcccccggg ctcactgcag gctcctgtgc agtcaacagc cctttgaggt ggtggagaag gcctgccgct cctacagcca cgtggtgctc aaggaggtgc gcttcttcaa cctgcagtcc ctctacccgc tgctgaaaga cccctccctc aacctgcata tcgtgcacct ggtccgggac ccccgggccg tgttccgttc ccgagaacgc acaaagggag atctcatgat tgacagtcgc attgtgatgg ggcagcatga gcaaaaactc aagaaggagg accaacccta ctatgtgatg caggtcatct gccaaagcca gctggagatc tacaagacca tccagtcctt gcccaaggcc ctgcaggaac gctacctgct tgtgcgctat gaggacctgg ctcgagcccc tgtggcccag acttcccgaa tgtatgaatt cgtgggattg gaattcttgc cccatcttca gacctgggtg cataacatca cccgaggcaa gggcatgggt gaccacgctt tccacacaaa tgccagggat gcccttaatg tctcccaggc ttggcgctgg tctttgccct atgaaaaggt ttctcgactt cagaaagcct gtggcgatgc catgaatttg ctgggctacc gccacgtcag atctgaacaa gaacagagaa acctgttgct ggatcttctg tctacctgga ctgtccctga gcaaatccac taa. It is sometimes possible for the material contained within the vial of "CHST4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.