Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CHRNA3 cdna clone

CHRNA3 cDNA Clone

Gene Names
CHRNA3; LNCR2; PAOD2; NACHRA3
Synonyms
CHRNA3; CHRNA3 cDNA Clone; CHRNA3 cdna clone
Ordering
For Research Use Only!
Sequence
atgggctctggcccgctctcgctgcccctggcgctgtcgccgccgcggctgctgctgctgctgctgctgtctctgctgccagtggccagggcctcagaggctgagcaccgtctatttgagcggctgtttgaagattacaatgagatcatccggcctgtagccaacgtgtctgacccagtcatcatccatttcgaggtgtccatgtctcagctggtgaaggtggatgaagtaaaccagatcatggagaccaacctgtggctcaagcaaatctggaatgactacaagctgaagtggaacccctctgactatggtggggcagagttcatgcgtgtccctgcacagaagatctggaagccagacattgtgctgtataacaatgctgttggggatttccaggtggacgacaagaccaaagccttactcaagtacactggggaggtgacttggatacctccggccatctttaagagctcctgtaaaatcgacgtgacctacttcccgtttgattaccaaaactgtaccatgaagttcggttcctggtcctacgataaggcgaaaatcgatctggtcctgatcggctcttccatgaacctcaaggactattgggagagcggcgagtgggccatcatcaaagccccaggctacaaacacgacatcaagtacaactgctgcgaggagatctaccccgacatcacatactcgctgtacatccggcgcctgcccttgttctacaccatcaacctcatcatcccctgcctgctcatctccttcctcactgtgctcgtcttctacctgccctccgactgcggtgagaaggtgaccctgtgcatttctgtcctcctctccctgacggtgtttctcctggtgatcactgagaccatcccttccacctcgctggtcatccccctgattggagagtacctcctgttcaccatgatttttgtaaccttgtccatcgtcatcaccgtcttcgtgctcaacgtgcactacagaaccccgacgacacacacaatgccctcatgggtgaagactgtattcttgaacctgctccccagggtcatgttcatgaccaggccaacaagcaacgagggcaacgctcagaagccgaggcccctctacggtgccgagctctcaaatctgaattgcttcagccgcgcagagtccaaaggctgcaaggagggctacccctgccaggacgggatgtgtggttactgccaccaccgcaggataaaaatctccaatttcagtgctaacctcacgagaagctctagttctgaatctgttgatgctgtgctgtccctctctgctttgtcaccagaaatcaaagaagccatccaaagtgtcaagtatattgctgaaaatatgaaagcacaaaatgaagccaaagagattcaagatgattggaagtatgttgccatggtgattgatcgtatttttctgtgggttttcaccctggtgtgcattctagggacagcaggattgtttctgcaacccctgatggccagggaagatgcataa
Sequence Length
1518
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,637 Da
NCBI Official Full Name
Homo sapiens cholinergic receptor, nicotinic, alpha 3, mRNA
NCBI Official Synonym Full Names
cholinergic receptor nicotinic alpha 3 subunit
NCBI Official Symbol
CHRNA3
NCBI Official Synonym Symbols
LNCR2; PAOD2; NACHRA3
NCBI Protein Information
neuronal acetylcholine receptor subunit alpha-3
UniProt Protein Name
Neuronal acetylcholine receptor subunit alpha-3
UniProt Gene Name
CHRNA3
UniProt Synonym Gene Names
NACHRA3
UniProt Entry Name
ACHA3_HUMAN

NCBI Description

This locus encodes a member of the nicotinic acetylcholine receptor family of proteins. Members of this family of proteins form pentameric complexes comprised of both alpha and beta subunits. This locus encodes an alpha-type subunit, as it contains characteristic adjacent cysteine residues. The encoded protein is a ligand-gated ion channel that likely plays a role in neurotransmission. Polymorphisms in this gene have been associated with an increased risk of smoking initiation and an increased susceptibility to lung cancer. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]

Uniprot Description

nAChRA3: After binding acetylcholine, the AChR responds by an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. Belongs to the ligand-gated ion channel (TC 1.A.9) family. Acetylcholine receptor (TC 1.A.9.1) subfamily. Alpha- 3/CHRNA3 sub-subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Channel, cation; Membrane protein, integral; Channel, ligand-gated; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 15q24

Cellular Component: cell soma; dendrite; nicotinic acetylcholine-gated receptor-channel complex; plasma membrane; postsynaptic density

Molecular Function: acetylcholine binding; acetylcholine receptor activity; ligand-gated ion channel activity; nicotinic acetylcholine-activated cation-selective channel activity

Biological Process: behavioral response to nicotine; locomotory behavior; nervous system development; regulation of acetylcholine secretion; regulation of dendrite morphogenesis; regulation of excitatory postsynaptic membrane potential; regulation of membrane potential; regulation of smooth muscle contraction; signal transduction; synaptic transmission involved in micturition; synaptic transmission, cholinergic; transmembrane receptor protein tyrosine kinase activation (dimerization)

Disease: Smoking As A Quantitative Trait Locus 3

Research Articles on CHRNA3

Similar Products

Product Notes

The CHRNA3 chrna3 (Catalog #AAA1278550) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggctctg gcccgctctc gctgcccctg gcgctgtcgc cgccgcggct gctgctgctg ctgctgctgt ctctgctgcc agtggccagg gcctcagagg ctgagcaccg tctatttgag cggctgtttg aagattacaa tgagatcatc cggcctgtag ccaacgtgtc tgacccagtc atcatccatt tcgaggtgtc catgtctcag ctggtgaagg tggatgaagt aaaccagatc atggagacca acctgtggct caagcaaatc tggaatgact acaagctgaa gtggaacccc tctgactatg gtggggcaga gttcatgcgt gtccctgcac agaagatctg gaagccagac attgtgctgt ataacaatgc tgttggggat ttccaggtgg acgacaagac caaagcctta ctcaagtaca ctggggaggt gacttggata cctccggcca tctttaagag ctcctgtaaa atcgacgtga cctacttccc gtttgattac caaaactgta ccatgaagtt cggttcctgg tcctacgata aggcgaaaat cgatctggtc ctgatcggct cttccatgaa cctcaaggac tattgggaga gcggcgagtg ggccatcatc aaagccccag gctacaaaca cgacatcaag tacaactgct gcgaggagat ctaccccgac atcacatact cgctgtacat ccggcgcctg cccttgttct acaccatcaa cctcatcatc ccctgcctgc tcatctcctt cctcactgtg ctcgtcttct acctgccctc cgactgcggt gagaaggtga ccctgtgcat ttctgtcctc ctctccctga cggtgtttct cctggtgatc actgagacca tcccttccac ctcgctggtc atccccctga ttggagagta cctcctgttc accatgattt ttgtaacctt gtccatcgtc atcaccgtct tcgtgctcaa cgtgcactac agaaccccga cgacacacac aatgccctca tgggtgaaga ctgtattctt gaacctgctc cccagggtca tgttcatgac caggccaaca agcaacgagg gcaacgctca gaagccgagg cccctctacg gtgccgagct ctcaaatctg aattgcttca gccgcgcaga gtccaaaggc tgcaaggagg gctacccctg ccaggacggg atgtgtggtt actgccacca ccgcaggata aaaatctcca atttcagtgc taacctcacg agaagctcta gttctgaatc tgttgatgct gtgctgtccc tctctgcttt gtcaccagaa atcaaagaag ccatccaaag tgtcaagtat attgctgaaa atatgaaagc acaaaatgaa gccaaagaga ttcaagatga ttggaagtat gttgccatgg tgattgatcg tatttttctg tgggttttca ccctggtgtg cattctaggg acagcaggat tgtttctgca acccctgatg gccagggaag atgcataa. It is sometimes possible for the material contained within the vial of "CHRNA3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.