Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CHMP4A cdna clone

CHMP4A cDNA Clone

Gene Names
CHMP4A; SNF7; CHMP4; SHAX2; CHMP4B; SNF7-1; VPS32A; HSPC134; VPS32-1; C14orf123
Synonyms
CHMP4A; CHMP4A cDNA Clone; CHMP4A cdna clone
Ordering
For Research Use Only!
Sequence
atgagtggtctcggcaggctcttcgggaaggggaagaaggagaaagggccaacccctgaagaagcaatacagaaactgaaggagacagagaagatactgatcaagaaacaggaatttttggagcagaagattcaacaggagctacaaacagccaagaagtatgggaccaagaataagagagctgccctacaggctttgcggaggaagaaaagattcgaacagcagctggcacaaactgacgggacattatccaccctggagtttcagcgtgaggccattgagaatgccactaccaatgcagaagtccttcgtaccatggagcttgctgcccaaagcatgaagaaggcctaccaggacatggacattgacaaggtagatgaactgatgactgacatcacggaacaacaggaggtggcccagcagatctcagatgccatttctcggcctatgggctttagagatgatgtggatgaggatgaactgctggaggagctagaggagctggagcaggaggaattggcccaggagttgttaaatgtgggcgacaaggaagaagaaccctcagtcaaattgcctagtgtaccttctactcatctgccggcagggccagctcccaaagtggatgaagatgaagaagcactaaagcagttggctgagtgggtatcctga
Sequence Length
669
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,804 Da
NCBI Official Full Name
Homo sapiens chromatin modifying protein 4A, mRNA
NCBI Official Synonym Full Names
charged multivesicular body protein 4A
NCBI Official Symbol
CHMP4A
NCBI Official Synonym Symbols
SNF7; CHMP4; SHAX2; CHMP4B; SNF7-1; VPS32A; HSPC134; VPS32-1; C14orf123
NCBI Protein Information
charged multivesicular body protein 4a
UniProt Protein Name
Charged multivesicular body protein 4a
UniProt Gene Name
CHMP4A
UniProt Synonym Gene Names
C14orf123; SHAX2; CHMP4a; hSnf-1; Vps32-1; hVps32-1
UniProt Entry Name
CHM4A_HUMAN

NCBI Description

CHMP4A belongs to the chromatin-modifying protein/charged multivesicular body protein (CHMP) family. These proteins are components of ESCRT-III (endosomal sorting complex required for transport III), a complex involved in degradation of surface receptor proteins and formation of endocytic multivesicular bodies (MVBs). Some CHMPs have both nuclear and cytoplasmic/vesicular distributions, and one such CHMP, CHMP1A (MIM 164010), is required for both MVB formation and regulation of cell cycle progression (Tsang et al., 2006 [PubMed 16730941]).[supplied by OMIM, Mar 2008]

Uniprot Description

CHMP4A: Probable core component of the endosomal sorting required for transport complex III (ESCRT-III) which is involved in multivesicular bodies (MVBs) formation and sorting of endosomal cargo proteins into MVBs. MVBs contain intraluminal vesicles (ILVs) that are generated by invagination and scission from the limiting membrane of the endosome and mostly are delivered to lysosomes enabling degradation of membrane proteins, such as stimulated growth factor receptors, lysosomal enzymes and lipids. The MVB pathway appears to require the sequential function of ESCRT-O, -I,-II and -III complexes. ESCRT-III proteins mostly dissociate from the invaginating membrane before the ILV is released. The ESCRT machinery also functions in topologically equivalent membrane fission events, such as the terminal stages of cytokinesis and the budding of enveloped viruses (HIV-1 and other lentiviruses). ESCRT-III proteins are believed to mediate the necessary vesicle extrusion and/or membrane fission activities, possibly in conjunction with the AAA ATPase VPS4. When overexpressed, membrane-assembled circular arrays of CHMP4A filaments can promote or stabilize negative curvature and outward budding. Via its interaction with PDCD6IP involved in HIV-1 p6- and p9-dependent virus release. Belongs to the SNF7 family.

Chromosomal Location of Human Ortholog: 14q12

Cellular Component: cytoplasm; cytosol; endosome; internal side of plasma membrane; membrane coat; midbody; nucleus; plasma membrane

Molecular Function: ATPase binding; identical protein binding; protein binding; protein homodimerization activity

Biological Process: autophagy; cell separation during cytokinesis; endosome transport; membrane budding; membrane invagination; mitotic metaphase plate congression; nuclear organization and biogenesis; posttranslational protein targeting to membrane; protein homooligomerization; protein polymerization; viral infectious cycle

Research Articles on CHMP4A

Similar Products

Product Notes

The CHMP4A chmp4a (Catalog #AAA1266212) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtggtc tcggcaggct cttcgggaag gggaagaagg agaaagggcc aacccctgaa gaagcaatac agaaactgaa ggagacagag aagatactga tcaagaaaca ggaatttttg gagcagaaga ttcaacagga gctacaaaca gccaagaagt atgggaccaa gaataagaga gctgccctac aggctttgcg gaggaagaaa agattcgaac agcagctggc acaaactgac gggacattat ccaccctgga gtttcagcgt gaggccattg agaatgccac taccaatgca gaagtccttc gtaccatgga gcttgctgcc caaagcatga agaaggccta ccaggacatg gacattgaca aggtagatga actgatgact gacatcacgg aacaacagga ggtggcccag cagatctcag atgccatttc tcggcctatg ggctttagag atgatgtgga tgaggatgaa ctgctggagg agctagagga gctggagcag gaggaattgg cccaggagtt gttaaatgtg ggcgacaagg aagaagaacc ctcagtcaaa ttgcctagtg taccttctac tcatctgccg gcagggccag ctcccaaagt ggatgaagat gaagaagcac taaagcagtt ggctgagtgg gtatcctga. It is sometimes possible for the material contained within the vial of "CHMP4A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.