Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CHI3L1 cdna clone

CHI3L1 cDNA Clone

Gene Names
CHI3L1; GP39; ASRT7; GP-39; YKL40; CGP-39; YKL-40; YYL-40; HC-gp39; HCGP-3P; hCGP-39
Synonyms
CHI3L1; CHI3L1 cDNA Clone; CHI3L1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggtgtgaaggcgtctcaaacaggctttgtggtcctggtgctgctccagtgctgctctgcatacaaactggtctgctactacaccagctggtcccagtaccgggaaggcgatgggagctgcttcccagatgcccttgaccgcttcctctgtacccacatcatctacagctttgccaatataagcaacgatcacatcgacacctgggagtggaatgatgtgacgctctacggcatgctcaacacactcaagaacaggaaccccaacctgaagactctcttgtctgtcggaggatggaactttgggtctcaaagattttccaagatagcctccaacacccagagtcgccggactttcatcaagtcagtaccgccatttctgcgcacccatggctttgatgggctggaccttgcctggctctaccctggacggggagacaaacagcattttaccaccctaatcaaggaaatgaaggccgaatttataaaggaagcccagccagggaaaaagcagctcctgctcagcgcagcactgtctgcggggaaggtcaccattgacagcagctatgacattgccaagatatcccaacacctggatttcattagcatcatgacctacgattttcatggagcctggcgtgggaccacaggccatcacagtcccctgttccgaggtcaggaggatgcaagtcctgacagattcagcaacactgactatgctgtggggtacatgttgaggctgggggctcctgccagtaagctggtgatgggcatccccaccttcgggaggagcttcactctggcttcttctgagactggtgttggagccccaatctcaggaccgggaattccaggccggttcaccaaggaggcagggacccttgcctactatgagatctgtgacttcctccgcggagccacagtccatagaatcctcggccagcaggtcccctatgccaccaagggcaaccagtgggtaggatacgacgaccaggaaagcgtcaaaagcaaggtgcagtacctgaaggacaggcagctggcgggcgccatggtatgggccctggacctggatgacttccagggctccttctgcggccaggatctgcgcttccctctcaccaatgccatcaaggatgcactcgctgcaacgtag
Sequence Length
1152
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,625 Da
NCBI Official Full Name
Homo sapiens chitinase 3-like 1 (cartilage glycoprotein-39), mRNA
NCBI Official Synonym Full Names
chitinase 3 like 1
NCBI Official Symbol
CHI3L1
NCBI Official Synonym Symbols
GP39; ASRT7; GP-39; YKL40; CGP-39; YKL-40; YYL-40; HC-gp39; HCGP-3P; hCGP-39
NCBI Protein Information
chitinase-3-like protein 1
UniProt Protein Name
Chitinase-3-like protein 1
Protein Family
UniProt Gene Name
CHI3L1
UniProt Synonym Gene Names
CGP-39; GP-39; hCGP-39
UniProt Entry Name
CH3L1_HUMAN

NCBI Description

Chitinases catalyze the hydrolysis of chitin, which is an abundant glycopolymer found in insect exoskeletons and fungal cell walls. The glycoside hydrolase 18 family of chitinases includes eight human family members. This gene encodes a glycoprotein member of the glycosyl hydrolase 18 family. The protein lacks chitinase activity and is secreted by activated macrophages, chondrocytes, neutrophils and synovial cells. The protein is thought to play a role in the process of inflammation and tissue remodeling. [provided by RefSeq, Sep 2009]

Uniprot Description

CHI3L1: Carbohydrate-binding lectin with a preference for chitin. May play a role in defense against pathogens, or in tissue remodeling. May play an important role in the capacity of cells to respond to and cope with changes in their environment. A genetic variation in CHI3L1 is associated with susceptibility to asthma-related traits type 7 (ASRT7). Asthma-related traits include clinical symptoms of asthma, such as coughing, wheezing and dyspnea, bronchial hyperresponsiveness (BHR) as assessed by methacholine challenge test, serum IgE levels, atopy, and atopic dermatitis. Belongs to the glycosyl hydrolase 18 family.

Protein type: Secreted; Secreted, signal peptide; Cell adhesion

Chromosomal Location of Human Ortholog: 1q32.1

Cellular Component: cytoplasm; endoplasmic reticulum; extracellular space

Molecular Function: chitin binding; chitinase activity

Biological Process: activation of NF-kappaB-inducing kinase; chitin catabolic process; inflammatory response; lung development; positive regulation of angiogenesis; positive regulation of protein kinase B signaling cascade; response to mechanical stimulus

Disease: Asthma-related Traits, Susceptibility To, 7; Schizophrenia

Research Articles on CHI3L1

Similar Products

Product Notes

The CHI3L1 chi3l1 (Catalog #AAA1275943) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtgtga aggcgtctca aacaggcttt gtggtcctgg tgctgctcca gtgctgctct gcatacaaac tggtctgcta ctacaccagc tggtcccagt accgggaagg cgatgggagc tgcttcccag atgcccttga ccgcttcctc tgtacccaca tcatctacag ctttgccaat ataagcaacg atcacatcga cacctgggag tggaatgatg tgacgctcta cggcatgctc aacacactca agaacaggaa ccccaacctg aagactctct tgtctgtcgg aggatggaac tttgggtctc aaagattttc caagatagcc tccaacaccc agagtcgccg gactttcatc aagtcagtac cgccatttct gcgcacccat ggctttgatg ggctggacct tgcctggctc taccctggac ggggagacaa acagcatttt accaccctaa tcaaggaaat gaaggccgaa tttataaagg aagcccagcc agggaaaaag cagctcctgc tcagcgcagc actgtctgcg gggaaggtca ccattgacag cagctatgac attgccaaga tatcccaaca cctggatttc attagcatca tgacctacga ttttcatgga gcctggcgtg ggaccacagg ccatcacagt cccctgttcc gaggtcagga ggatgcaagt cctgacagat tcagcaacac tgactatgct gtggggtaca tgttgaggct gggggctcct gccagtaagc tggtgatggg catccccacc ttcgggagga gcttcactct ggcttcttct gagactggtg ttggagcccc aatctcagga ccgggaattc caggccggtt caccaaggag gcagggaccc ttgcctacta tgagatctgt gacttcctcc gcggagccac agtccataga atcctcggcc agcaggtccc ctatgccacc aagggcaacc agtgggtagg atacgacgac caggaaagcg tcaaaagcaa ggtgcagtac ctgaaggaca ggcagctggc gggcgccatg gtatgggccc tggacctgga tgacttccag ggctccttct gcggccagga tctgcgcttc cctctcacca atgccatcaa ggatgcactc gctgcaacgt ag. It is sometimes possible for the material contained within the vial of "CHI3L1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.