Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CHD9 cdna clone

CHD9 cDNA Clone

Gene Names
CHD9; AD013; CHD-9; CReMM; KISH2; PRIC320
Synonyms
CHD9; CHD9 cDNA Clone; CHD9 cdna clone
Ordering
For Research Use Only!
Sequence
atgttaatcaatcttttggtagcccagctgaacatgtgttatctccacactctcagtttaattgttctccaatccatccccaaaaccaacccaatggtttgtttccagatgtatcagatggcagtccaatgtggggccatcagacagctactaccatttcaaatcaaaatggatctccttttcaccaacaaggacattcacactctatgcatcaaaataaaagctttgtggcacaccatgactttgccttatttcaggccaatgaacaacaaacacagtgtacttcactacgctcacaacaaaacagaaataatctcaacccagggcagaattctcttagccagtctaaaaattttatga
Sequence Length
360
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
324,127 Da
NCBI Official Full Name
Homo sapiens chromodomain helicase DNA binding protein 9, mRNA
NCBI Official Synonym Full Names
chromodomain helicase DNA binding protein 9
NCBI Official Symbol
CHD9
NCBI Official Synonym Symbols
AD013; CHD-9; CReMM; KISH2; PRIC320
NCBI Protein Information
chromodomain-helicase-DNA-binding protein 9
UniProt Protein Name
Chromodomain-helicase-DNA-binding protein 9
UniProt Gene Name
CHD9
UniProt Synonym Gene Names
KIAA0308; KISH2; PRIC320; CHD-9; CReMM
UniProt Entry Name
CHD9_HUMAN

Uniprot Description

CHD-9: Acts as a transcriptional coactivator for PPARA and possibly other nuclear receptors. Proposed to be a ATP-dependent chromatin remodeling protein. Has DNA-dependent ATPase activity and binds to A/T-rich DNA. Associates with A/T-rich regulatory regions in promoters of genes that participate in the differentiation of progenitors during osteogenesis. Belongs to the SNF2/RAD54 helicase family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 3.6.4.12; Helicase; DNA-binding

Chromosomal Location of Human Ortholog: 16q12.2

Cellular Component: cytoplasm; nucleoplasm; nucleus; plasma membrane

Biological Process: cellular lipid metabolic process

Research Articles on CHD9

Similar Products

Product Notes

The CHD9 chd9 (Catalog #AAA1269689) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttaatca atcttttggt agcccagctg aacatgtgtt atctccacac tctcagttta attgttctcc aatccatccc caaaaccaac ccaatggttt gtttccagat gtatcagatg gcagtccaat gtggggccat cagacagcta ctaccatttc aaatcaaaat ggatctcctt ttcaccaaca aggacattca cactctatgc atcaaaataa aagctttgtg gcacaccatg actttgcctt atttcaggcc aatgaacaac aaacacagtg tacttcacta cgctcacaac aaaacagaaa taatctcaac ccagggcaga attctcttag ccagtctaaa aattttatga. It is sometimes possible for the material contained within the vial of "CHD9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.