CGRRF1 cdna clone

CGRRF1 cDNA Clone

Gene Names

CGRRF1; CGR19; RNF197

Synonyms

CGRRF1; CGRRF1 cDNA Clone; CGRRF1 cdna clone

Ordering
Cat. Num. AAA1277121 For Research Use Only!

Sequence

atggctgcggtgtttctggtaacgctttatgaatactcgccgcttttctacatcgcggtggtctttacctgcttcatcgtgaccaccggcctggtattgggatggtttggttgggatgttccagtaattctgagaaattcagaagagacccagttcagcacaagagttttcaaaaagcaaatgagacaagtcaagaatccttttggcttagagatcactaatccatcttcagcttcaattacaactggcataaccttgacaacagattgccttgaagatagcctccttacatgctactgggggtgcaatgttcaaaaattatatgaagctctgcagaagcatgtttattgcttcagaataagcactccccaagcattagaagatgctctgtatagtgaatatctctatcaggaacagtattttattaaaaaggatagcaaagaagaaatatattgccagttaccaagagatactaaaattgaagactttggtacagtacccagatctcgctatccattggtagcgctattgaccttagctgatgaggatgaccgggaaatttatgatattatttccatggtgtcagtgattcatattcctgataggacttataaactatcctgcagaatattgtatcaatatttactcttggctcaaggtcaatttcatgatcttaagcaacttttcatgtctgcaaataataatttcactccctccaacaattcctcttcagaagaaaaaaacacagacagaagtttgttggaaaaggtgggactctctgaaagtgaagttgagccatcggaagagaacagcaaggactgtgttgtttgccagaatgggactgtgaactgggtactcttaccatgcagacacacatgcctgtgtgatggctgtgtgaagtattttcagcagtgcccaatgtgcaggcagtttgttcaggaatcttttgcactttgcagtcaaaaagagcaagataaagacaaaccgaagactctttga

Sequence Length

999

Vector

Please Inquire

NCBI and Uniprot Product Information

NCBI GI #

15929230

NCBI GeneID

10668

Molecular Weight

38,242 Da

NCBI Official Full Name

Homo sapiens cell growth regulator with ring finger domain 1, mRNA

NCBI Official Synonym Full Names

cell growth regulator with ring finger domain 1

NCBI Official Symbol

CGRRF1

NCBI Official Synonym Symbols

CGR19; RNF197

NCBI Protein Information

cell growth regulator with RING finger domain protein 1

UniProt Protein Name

Cell growth regulator with RING finger domain protein 1

Protein Family

Cell growth regulator with RING finger domain protein

UniProt Gene Name

CGRRF1

UniProt Synonym Gene Names

CGR19; RNF197

UniProt Entry Name

CGRF1_HUMAN

Uniprot Description

CGRRF1: Able to inhibit growth in several cell lines.

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 14q22.2

Cellular Component: intracellular membrane-bound organelle; nucleoplasm

Biological Process: negative regulation of cell proliferation; response to stress

Research Articles on CGRRF1

1. CGRRF1 represents a novel, reproducible tissue marker of metformin response in the obese endometrium and our preliminary data suggests that up-regulation of CGRRF1 expression may prove clinically useful in the prevention or treatment of endometrial cancer

Similar Products

Product Notes

The CGRRF1 cgrrf1 (Catalog #AAA1277121) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgcgg tgtttctggt aacgctttat gaatactcgc cgcttttcta catcgcggtg gtctttacct gcttcatcgt gaccaccggc ctggtattgg gatggtttgg ttgggatgtt ccagtaattc tgagaaattc agaagagacc cagttcagca caagagtttt caaaaagcaa atgagacaag tcaagaatcc ttttggctta gagatcacta atccatcttc agcttcaatt acaactggca taaccttgac aacagattgc cttgaagata gcctccttac atgctactgg gggtgcaatg ttcaaaaatt atatgaagct ctgcagaagc atgtttattg cttcagaata agcactcccc aagcattaga agatgctctg tatagtgaat atctctatca ggaacagtat tttattaaaa aggatagcaa agaagaaata tattgccagt taccaagaga tactaaaatt gaagactttg gtacagtacc cagatctcgc tatccattgg tagcgctatt gaccttagct gatgaggatg accgggaaat ttatgatatt atttccatgg tgtcagtgat tcatattcct gataggactt ataaactatc ctgcagaata ttgtatcaat atttactctt ggctcaaggt caatttcatg atcttaagca acttttcatg tctgcaaata ataatttcac tccctccaac aattcctctt cagaagaaaa aaacacagac agaagtttgt tggaaaaggt gggactctct gaaagtgaag ttgagccatc ggaagagaac agcaaggact gtgttgtttg ccagaatggg actgtgaact gggtactctt accatgcaga cacacatgcc tgtgtgatgg ctgtgtgaag tattttcagc agtgcccaat gtgcaggcag tttgttcagg aatcttttgc actttgcagt caaaaagagc aagataaaga caaaccgaag actctttga. It is sometimes possible for the material contained within the vial of "CGRRF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

CGRRF1 cdna clone