Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CGB cdna clone

CGB cDNA Clone

Gene Names
CGB3; CGB; CGB5; CGB7; CGB8; hCGB
Synonyms
CGB; CGB cDNA Clone; CGB cdna clone
Ordering
For Research Use Only!
Sequence
atggagatgttccaggggctgctgctgttgctgctgctgagcatgggcgggacatgggcatccaaggagccgcttcggccacggtgccgccccatcaatgccaccctggctgtggagaaggagggctgccccgtgtgcatcaccgtcaacaccaccatctgtgccggctactgccccaccatgacccgcgtgctgcagggggtcctgccggccctgcctcaggtggtgtgcaactaccgcgatgtgcgcttcgagtccatccggctccctggctgcccgcgcggcgtgaaccccgtggtctcctacgccgtggctctcagctgtcaatgtgcactctgccgccgcagcaccactgactgcgggggtcccaaggaccaccccttgacctgtgatgacccccgcttccaggactcctcttcctcaaaggcccctcccccgagccttccaagtccatcccgactcccggggccctcggacaccccgatcctcccacaataa
Sequence Length
498
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,053 Da
NCBI Official Full Name
Homo sapiens chorionic gonadotropin, beta polypeptide, mRNA
NCBI Official Synonym Full Names
chorionic gonadotropin beta subunit 3
NCBI Official Symbol
CGB3
NCBI Official Synonym Symbols
CGB; CGB5; CGB7; CGB8; hCGB
NCBI Protein Information
choriogonadotropin subunit beta 3
UniProt Protein Name
Choriogonadotropin subunit beta 3
Protein Family
UniProt Gene Name
CGB3
UniProt Synonym Gene Names
CGB; CG-beta
UniProt Entry Name
CGB3_HUMAN

NCBI Description

This gene is a member of the glycoprotein hormone beta chain family and encodes the beta 3 subunit of chorionic gonadotropin (CG). Glycoprotein hormones are heterodimers consisting of a common alpha subunit and an unique beta subunit which confers biological specificity. CG is produced by the trophoblastic cells of the placenta and stimulates the ovaries to synthesize the steroids that are essential for the maintenance of pregnancy. The beta subunit of CG is encoded by 6 genes which are arranged in tandem and inverted pairs on chromosome 19q13.3 and contiguous with the luteinizing hormone beta subunit gene. [provided by RefSeq, Jul 2008]

Uniprot Description

CGB: Stimulates the ovaries to synthesize the steroids that are essential for the maintenance of pregnancy. Belongs to the glycoprotein hormones subunit beta family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted; Secreted, signal peptide; Inhibitor

Chromosomal Location of Human Ortholog: 19q13.32

Research Articles on CGB

Similar Products

Product Notes

The CGB cgb3 (Catalog #AAA1275315) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagatgt tccaggggct gctgctgttg ctgctgctga gcatgggcgg gacatgggca tccaaggagc cgcttcggcc acggtgccgc cccatcaatg ccaccctggc tgtggagaag gagggctgcc ccgtgtgcat caccgtcaac accaccatct gtgccggcta ctgccccacc atgacccgcg tgctgcaggg ggtcctgccg gccctgcctc aggtggtgtg caactaccgc gatgtgcgct tcgagtccat ccggctccct ggctgcccgc gcggcgtgaa ccccgtggtc tcctacgccg tggctctcag ctgtcaatgt gcactctgcc gccgcagcac cactgactgc gggggtccca aggaccaccc cttgacctgt gatgaccccc gcttccagga ctcctcttcc tcaaaggccc ctcccccgag ccttccaagt ccatcccgac tcccggggcc ctcggacacc ccgatcctcc cacaataa. It is sometimes possible for the material contained within the vial of "CGB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.