Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CGA cdna clone

CGA cDNA Clone

Gene Names
CGA; HCG; LHA; FSHA; GPHa; TSHA; GPHA1; CG-ALPHA
Synonyms
CGA; CGA cDNA Clone; CGA cdna clone
Ordering
For Research Use Only!
Sequence
atggattactacagaaaatatgcagctatctttctggtcacattgtcggtgtttctgcatgttctccattccgctcctgatgtgcaggattgcccagaatgcacgctacaggaaaacccattcttctcccagccgggtgccccaatacttcagtgcatgggctgctgcttctctagagcatatcccactccactaaggtccaagaagacgatgttggtccaaaagaacgtcacctcagagtccacttgctgtgtagctaaatcatataacagggtcacagtaatggggggtttcaaagtggagaaccacacggcgtgccactgcagtacttgttattatcacaaatcttaa
Sequence Length
351
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,075 Da
NCBI Official Full Name
Homo sapiens glycoprotein hormones, alpha polypeptide, mRNA
NCBI Official Synonym Full Names
glycoprotein hormones, alpha polypeptide
NCBI Official Symbol
CGA
NCBI Official Synonym Symbols
HCG; LHA; FSHA; GPHa; TSHA; GPHA1; CG-ALPHA
NCBI Protein Information
glycoprotein hormones alpha chain
UniProt Protein Name
Glycoprotein hormones alpha chain
Protein Family
UniProt Gene Name
CGA
UniProt Synonym Gene Names
CG-alpha; FSH-alpha; LSH-alpha; TSH-alpha
UniProt Entry Name
GLHA_HUMAN

NCBI Description

The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]

Uniprot Description

CGA: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 6q12-q21

Cellular Component: extracellular region; Golgi lumen

Molecular Function: hormone activity; protein binding

Biological Process: cell-cell signaling; peptide hormone processing; signal transduction

Research Articles on CGA

Similar Products

Product Notes

The CGA cga (Catalog #AAA1277211) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggattact acagaaaata tgcagctatc tttctggtca cattgtcggt gtttctgcat gttctccatt ccgctcctga tgtgcaggat tgcccagaat gcacgctaca ggaaaaccca ttcttctccc agccgggtgc cccaatactt cagtgcatgg gctgctgctt ctctagagca tatcccactc cactaaggtc caagaagacg atgttggtcc aaaagaacgt cacctcagag tccacttgct gtgtagctaa atcatataac agggtcacag taatgggggg tttcaaagtg gagaaccaca cggcgtgcca ctgcagtact tgttattatc acaaatctta a. It is sometimes possible for the material contained within the vial of "CGA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.