CFHR2 cdna clone
CFHR2 cDNA Clone
Gene Names
CFHR2; FHR2; HFL3; CFHL2
Synonyms
CFHR2; CFHR2 cDNA Clone; CFHR2 cdna clone
Sequence
atgtggctcctggtcagtgtaattctaatctcacggatatcctctgttgggggagaagcaatgttctgtgattttccaaaaataaaccatggaattctatatgatgaagaaaaatataagccattttcccaagttcctacaggggaagttttctattactcctgtgaatataattttgtgtctccttcaaaatccttttggactcgcataacgtgcgcagaagaaggatggtcaccaacaccaaagtgtctcagactgtgtttctttccttttgtggaaaatggtcattctgaatcttcaggacaaacacatctggaaggtgatactgtacaaattatttgcaacacaggatacagacttcaaaacaatgagaacaacatttcatgtgtagaacggggctggtccactcctcccaaatgcaggtccactatttctgcagaaaaatgtgggccccctccacctattgacaatggagacattacttcattcctgttgtcagtatatgctccaggttcatcagttgagtaccagtgccagaacttgtatcaacttgagggtaacaatcaaataacatgtagaaacggacaatggtcagaaccaccaaaatgcttagatccatgtgtaatatcacaagaaattatggaaaaatataacataaaattaaagtggacaaaccaacaaaagctttattcaagaacaggtgacatagttgaatttgtttgtaaatctggatatcatccaacaaaatctcattcatttcgagcaatgtgtcagaatgggaaactggtatatcccagttgtgaagaaaaatag
Sequence Length
813
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
27,897 Da
NCBI Official Full Name
Homo sapiens complement factor H-related 2, mRNA
NCBI Official Synonym Full Names
complement factor H related 2
NCBI Official Symbol
CFHR2
NCBI Official Synonym Symbols
FHR2; HFL3; CFHL2
NCBI Protein Information
complement factor H-related protein 2
UniProt Protein Name
Complement factor H-related protein 2
Protein Family
UniProt Gene Name
CFHR2
UniProt Synonym Gene Names
CFHL2; FHR2; HFL3; FHR-2
UniProt Entry Name
FHR2_HUMAN
NCBI Description
This gene belongs to a family of complement factor H-related genes (CFHR), which are clustered together with complement factor H gene on chromosome 1, and are involved in regulation of complement. Mutations in CFHR genes have been associated with dense deposit disease and atypical haemolytic-uraemic syndrome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2015]
Uniprot Description
CFHR2: Might be involved in complement regulation. Can associate with lipoproteins and may play a role in lipid metabolism. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Secreted; Secreted, signal peptide
Chromosomal Location of Human Ortholog: 1q31.3
Research Articles on CFHR2
Similar Products
Product Notes
The CFHR2 cfhr2 (Catalog #AAA1268155) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggctcc tggtcagtgt aattctaatc tcacggatat cctctgttgg gggagaagca atgttctgtg attttccaaa aataaaccat ggaattctat atgatgaaga aaaatataag ccattttccc aagttcctac aggggaagtt ttctattact cctgtgaata taattttgtg tctccttcaa aatccttttg gactcgcata acgtgcgcag aagaaggatg gtcaccaaca ccaaagtgtc tcagactgtg tttctttcct tttgtggaaa atggtcattc tgaatcttca ggacaaacac atctggaagg tgatactgta caaattattt gcaacacagg atacagactt caaaacaatg agaacaacat ttcatgtgta gaacggggct ggtccactcc tcccaaatgc aggtccacta tttctgcaga aaaatgtggg ccccctccac ctattgacaa tggagacatt acttcattcc tgttgtcagt atatgctcca ggttcatcag ttgagtacca gtgccagaac ttgtatcaac ttgagggtaa caatcaaata acatgtagaa acggacaatg gtcagaacca ccaaaatgct tagatccatg tgtaatatca caagaaatta tggaaaaata taacataaaa ttaaagtgga caaaccaaca aaagctttat tcaagaacag gtgacatagt tgaatttgtt tgtaaatctg gatatcatcc aacaaaatct cattcatttc gagcaatgtg tcagaatggg aaactggtat atcccagttg tgaagaaaaa tag. It is sometimes possible for the material contained within the vial of "CFHR2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
