Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CETP cdna clone

CETP cDNA Clone

Gene Names
CETP; BPIFF; HDLCQ10
Synonyms
CETP; CETP cDNA Clone; CETP cdna clone
Ordering
For Research Use Only!
Sequence
atgctggctgccacagtcctgaccctggccctgctgggcaatgcccatgcctgctccaaaggcacctcgcacgaggcaggcatcgtgtgccgcatcaccaagcctgccctcctggtgttgaaccacgagactgccaaggtgatccagaccgccttccagcgagccagctacccagatatcacgggcgagaaggccatgatgctccttggccaagtcaagtatgggttgcacaacatccagatcagccacttgtccatcgccagcagccaggtggagctggtggaagccaagtccattgatgtctccattcagaacgtgtctgtggtcttcaaggggaccctgaagtatggctacaccactgcctggtggctgggtattgatcagtccattgacttcgagatcgactctgccattgacctccagatcaacacacagctgacctgtgactctggtagagtgcggaccgatgcccctgactgctacctgtctttccataagctgctcctgcatctccaaggggagcgagagcctgggtggatcaagcagctgttcacaaatttcatctccttcaccctgaagctggtcctgaagggacagatctgcaaagagatcaacgtcatctctaacatcatggccgattttgtccagacaagggctgccagcatcctttcagatggagacattggggtggacatttccctgacaggtgatcccgtcatcacagcctcctacctggagtcccatcacaagggtcatttcatctacaagaatgtctcagaggacctccccctccccaccttctcgcccacactgctgggggactcccgcatgctgtacttctggttctctgagcgagtcttccactcgctggccaaggtagctttccaggatggccgcctcatgctcagcctgatgggagacgagttcaaggcagtgctggagacctggggcttcaacaccaaccaggaaatcttccaagaggttgtcggcggcttccccagccaggcccaagtcaccgtccactgcctcaagatgcccaagatctcctgccaaaacaagggagtcgtggtcaattcttcagtgatggtgaaattcctctttccacgcccagaccagcaacattctgtagcttacacatttgaagaggatatcgtgactaccgtccaggcctcctattctaagaaaaagctcttcttaagcctcttggatttccagattacaccaaagactgtttccaacttgactgagagcagctccgagtccatccagagcttcctgcagtcaatgatcaccgctgtgggcatccctgaggtcatgtctcggctcgaggtagtgtttacagccctcatgaacagcaaaggcgtgagcctcttcgacatcatcaaccctgagattatcactcgagatggcttcctgctgctgcagatggactttggcttccctgagcacctgctggtggatttcctccagagcttgagctag
Sequence Length
1482
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,787 Da
NCBI Official Full Name
Homo sapiens cholesteryl ester transfer protein, plasma, mRNA
NCBI Official Synonym Full Names
cholesteryl ester transfer protein
NCBI Official Symbol
CETP
NCBI Official Synonym Symbols
BPIFF; HDLCQ10
NCBI Protein Information
cholesteryl ester transfer protein
UniProt Protein Name
Cholesteryl ester transfer protein
UniProt Gene Name
CETP
UniProt Entry Name
CETP_HUMAN

NCBI Description

The protein encoded by this gene is found in plasma, where it is involved in the transfer of cholesteryl ester from high density lipoprotein (HDL) to other lipoproteins. Defects in this gene are a cause of hyperalphalipoproteinemia 1 (HALP1). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]

Uniprot Description

CETP: Involved in the transfer of insoluble cholesteryl esters in the reverse transport of cholesterol. Defects in CETP are the cause of hyperalphalipoproteinemia type 1 (HALP1). Affected individuals show high levels of alpha-lipoprotein (high density lipoprotein/HDL). Belongs to the BPI/LBP/Plunc superfamily. BPI/LBP family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Vesicle; Secreted, signal peptide; Secreted; Lipid-binding

Chromosomal Location of Human Ortholog: 16q21

Cellular Component: extracellular region; extracellular space; vesicle

Molecular Function: cholesterol binding; cholesterol transporter activity; lipid binding; lipid transporter activity; phosphatidylcholine binding; phospholipid transporter activity; triglyceride binding

Biological Process: cholesterol homeostasis; cholesterol metabolic process; cholesterol transport; lipid homeostasis; lipid transport; lipoprotein metabolic process; phosphatidylcholine metabolic process; phospholipid homeostasis; phospholipid transport; receptor-mediated endocytosis; reverse cholesterol transport; triacylglycerol metabolic process; triacylglycerol transport

Disease: Hyperalphalipoproteinemia 1

Research Articles on CETP

Similar Products

Product Notes

The CETP cetp (Catalog #AAA1268617) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggctg ccacagtcct gaccctggcc ctgctgggca atgcccatgc ctgctccaaa ggcacctcgc acgaggcagg catcgtgtgc cgcatcacca agcctgccct cctggtgttg aaccacgaga ctgccaaggt gatccagacc gccttccagc gagccagcta cccagatatc acgggcgaga aggccatgat gctccttggc caagtcaagt atgggttgca caacatccag atcagccact tgtccatcgc cagcagccag gtggagctgg tggaagccaa gtccattgat gtctccattc agaacgtgtc tgtggtcttc aaggggaccc tgaagtatgg ctacaccact gcctggtggc tgggtattga tcagtccatt gacttcgaga tcgactctgc cattgacctc cagatcaaca cacagctgac ctgtgactct ggtagagtgc ggaccgatgc ccctgactgc tacctgtctt tccataagct gctcctgcat ctccaagggg agcgagagcc tgggtggatc aagcagctgt tcacaaattt catctccttc accctgaagc tggtcctgaa gggacagatc tgcaaagaga tcaacgtcat ctctaacatc atggccgatt ttgtccagac aagggctgcc agcatccttt cagatggaga cattggggtg gacatttccc tgacaggtga tcccgtcatc acagcctcct acctggagtc ccatcacaag ggtcatttca tctacaagaa tgtctcagag gacctccccc tccccacctt ctcgcccaca ctgctggggg actcccgcat gctgtacttc tggttctctg agcgagtctt ccactcgctg gccaaggtag ctttccagga tggccgcctc atgctcagcc tgatgggaga cgagttcaag gcagtgctgg agacctgggg cttcaacacc aaccaggaaa tcttccaaga ggttgtcggc ggcttcccca gccaggccca agtcaccgtc cactgcctca agatgcccaa gatctcctgc caaaacaagg gagtcgtggt caattcttca gtgatggtga aattcctctt tccacgccca gaccagcaac attctgtagc ttacacattt gaagaggata tcgtgactac cgtccaggcc tcctattcta agaaaaagct cttcttaagc ctcttggatt tccagattac accaaagact gtttccaact tgactgagag cagctccgag tccatccaga gcttcctgca gtcaatgatc accgctgtgg gcatccctga ggtcatgtct cggctcgagg tagtgtttac agccctcatg aacagcaaag gcgtgagcct cttcgacatc atcaaccctg agattatcac tcgagatggc ttcctgctgc tgcagatgga ctttggcttc cctgagcacc tgctggtgga tttcctccag agcttgagct ag. It is sometimes possible for the material contained within the vial of "CETP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.