Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CEP97 cdna clone

CEP97 cDNA Clone

Gene Names
CEP97; LRRIQ2; 2810403B08Rik
Synonyms
CEP97; CEP97 cDNA Clone; CEP97 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggtggcgcgcgtggacgcggctttgcctcccggagaaggatcagtggtcaattggtcaggacagggactacagaaattaggtccaaatttaccctgtgaagctgatattcacactttgattctggataaaaatcagattattaaattggaaaatctggagaaatgcaaacgattaatacagttatcagtagctaataatcggctggttcggatgatgggtgtggccaagctgacgttgcttcgtgtattaaatttgcctcataatagcattggctgtgtggaagggctaaaggaactagtacatctggaatggctgaatttggcaggaaataatcttaaggccatggaacagatcaatagctgcacagctctacagcatctcgatttatcagacaataatatatcccagataggtgatctatctaaattggtatccctgaaaaccctgcttttacatggaaacatcatcacctctcttagaatggcacctgcttacctacccagaagtcttgctatactttctttggcagaaaatgaaatccgagacttaaatgagatctcttttttggcatccttaactgaattggaacagttgtcgattatgaacaatccttgtgtgatggcaacaccatccatcccaggatttgactatcggccgtacatcgtcagctggtgcctaaacctcagagtcctagatggatatgtgatttctcagaaggaaagtttgaaagctgaatggctctatagtcaaggcaaggggagagcatatcggcctggccagcacatccagcttgtccaatatctggctacagtctgccccctcacttctacactaggtcttcaaactgcagaggatgccaaactagagaagattttgagcaaacagaggtttcaccagaggcagttgatgaaccaaagccaaaatgaagagttgtctcctcttgttcctgttgaaacaagggcatcccttattcctgagcattcaagccctgttcaagattgccagatatcccaggaaagtgaacccgtcattcaagtgaattcttgggttgggataaacagtaatgatgatcagttatttgcggttaagaataattttccagcctctgtacacactacgagatattctcgaaatgatctgcacctggaagacatacagacggatgaggacaagttaaactgtagtcttctctcttcagagtctacttttatgccagttgcatcaggactgtctccactatcacctacagttgagctgaggctgcagggcattaacttgggcctagaagatgatggtgttgcagatgaatctgtgaaagggctggaaagccaggtgttggataaggaagaggaacagcctttatgggctgcaaatgagaattctgttcaaatgatgagaagtgaaatcaatacagaggtaaatgagaaagctggactattaccttgtcctgagccaacaataatcagtgctatcttgaaggatgataaccacagtcttacattttttcctgagtcaactgagcagaaacaatcagacataaagaaaccagaaaatacacaaccagaaaataaagaaaccatatctcaagcaacttcagagaaacttcccatgattttaacccagagatctgttgctttgggacaagacaaagttgcccttcagaaattaaatgatgcagccaccaagcttcaggcctgttggcggggattttatgccaggaactacaaccctcaagccaaagatgtgcgttacgaaatccggctacgcagaatgcaagagcacattgtctgcttaactgatgaaataaggagattacgaaaagaaagagatgaagaacgtattaaaaaatttgtacaagaagaagctttcagattcctttggaaccaggtaaggtctctacaggtttggcaacagacagtggaccagcgtctaagttcctggcatactgatgttcctcctatatcaagtactcttgtgccatcgaaacatccattatttacccaaagccaggagtcctcttgtgatcaaaatgctgattggtttattgcttctgatgtagctcctcaagagaaatcattaccagaatttccagactctggttttcattcctctctaacagaacaagttcattcattgcagcattctttggattttgagaaaagttccacagaaggcagtgaaagctccataatggggaattccattgacacagtcagatatggcaaagaatcagatttaggggatgttagtgaagaacatggtgaatggaataaggaaagctcaaataacgagcaggacaatagtctgcttgaacagtatttaacttcagttcaacagctggaagatgctgatgagaggaccaattttgatacagagacaagagatagcaaacttcacattgcttgtttcccagtacagttagatacattgtctgacggtgcttctgtagatgagagtcatggcatatctcctcctttgcaaggtgaaattagccagacacaagagaattctaaattaaatgcagaagttcaagggcagcagccagaatgtgattctacatttcagctattgcatgttggtgttactgtgtag
Sequence Length
2598
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
99,909 Da
NCBI Official Full Name
Homo sapiens centrosomal protein 97kDa, mRNA
NCBI Official Synonym Full Names
centrosomal protein 97
NCBI Official Symbol
CEP97
NCBI Official Synonym Symbols
LRRIQ2; 2810403B08Rik
NCBI Protein Information
centrosomal protein of 97 kDa
UniProt Protein Name
Centrosomal protein of 97 kDa
Protein Family
UniProt Gene Name
CEP97
UniProt Synonym Gene Names
LRRIQ2; Cep97
UniProt Entry Name
CEP97_HUMAN

Uniprot Description

LRRIQ2: Collaborates with CCP110, being involved in the suppression of a cilia assembly program. Required for correct spindle formation and has a role in cytokinesis. Required for recruitment of CCP110 to the centrosome. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 3q12.3

Cellular Component: centrosome; cytoplasm; cytosol; microtubule organizing center; protein complex

Molecular Function: protein binding

Similar Products

Product Notes

The CEP97 cep97 (Catalog #AAA1277449) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggtgg cgcgcgtgga cgcggctttg cctcccggag aaggatcagt ggtcaattgg tcaggacagg gactacagaa attaggtcca aatttaccct gtgaagctga tattcacact ttgattctgg ataaaaatca gattattaaa ttggaaaatc tggagaaatg caaacgatta atacagttat cagtagctaa taatcggctg gttcggatga tgggtgtggc caagctgacg ttgcttcgtg tattaaattt gcctcataat agcattggct gtgtggaagg gctaaaggaa ctagtacatc tggaatggct gaatttggca ggaaataatc ttaaggccat ggaacagatc aatagctgca cagctctaca gcatctcgat ttatcagaca ataatatatc ccagataggt gatctatcta aattggtatc cctgaaaacc ctgcttttac atggaaacat catcacctct cttagaatgg cacctgctta cctacccaga agtcttgcta tactttcttt ggcagaaaat gaaatccgag acttaaatga gatctctttt ttggcatcct taactgaatt ggaacagttg tcgattatga acaatccttg tgtgatggca acaccatcca tcccaggatt tgactatcgg ccgtacatcg tcagctggtg cctaaacctc agagtcctag atggatatgt gatttctcag aaggaaagtt tgaaagctga atggctctat agtcaaggca aggggagagc atatcggcct ggccagcaca tccagcttgt ccaatatctg gctacagtct gccccctcac ttctacacta ggtcttcaaa ctgcagagga tgccaaacta gagaagattt tgagcaaaca gaggtttcac cagaggcagt tgatgaacca aagccaaaat gaagagttgt ctcctcttgt tcctgttgaa acaagggcat cccttattcc tgagcattca agccctgttc aagattgcca gatatcccag gaaagtgaac ccgtcattca agtgaattct tgggttggga taaacagtaa tgatgatcag ttatttgcgg ttaagaataa ttttccagcc tctgtacaca ctacgagata ttctcgaaat gatctgcacc tggaagacat acagacggat gaggacaagt taaactgtag tcttctctct tcagagtcta cttttatgcc agttgcatca ggactgtctc cactatcacc tacagttgag ctgaggctgc agggcattaa cttgggccta gaagatgatg gtgttgcaga tgaatctgtg aaagggctgg aaagccaggt gttggataag gaagaggaac agcctttatg ggctgcaaat gagaattctg ttcaaatgat gagaagtgaa atcaatacag aggtaaatga gaaagctgga ctattacctt gtcctgagcc aacaataatc agtgctatct tgaaggatga taaccacagt cttacatttt ttcctgagtc aactgagcag aaacaatcag acataaagaa accagaaaat acacaaccag aaaataaaga aaccatatct caagcaactt cagagaaact tcccatgatt ttaacccaga gatctgttgc tttgggacaa gacaaagttg cccttcagaa attaaatgat gcagccacca agcttcaggc ctgttggcgg ggattttatg ccaggaacta caaccctcaa gccaaagatg tgcgttacga aatccggcta cgcagaatgc aagagcacat tgtctgctta actgatgaaa taaggagatt acgaaaagaa agagatgaag aacgtattaa aaaatttgta caagaagaag ctttcagatt cctttggaac caggtaaggt ctctacaggt ttggcaacag acagtggacc agcgtctaag ttcctggcat actgatgttc ctcctatatc aagtactctt gtgccatcga aacatccatt atttacccaa agccaggagt cctcttgtga tcaaaatgct gattggttta ttgcttctga tgtagctcct caagagaaat cattaccaga atttccagac tctggttttc attcctctct aacagaacaa gttcattcat tgcagcattc tttggatttt gagaaaagtt ccacagaagg cagtgaaagc tccataatgg ggaattccat tgacacagtc agatatggca aagaatcaga tttaggggat gttagtgaag aacatggtga atggaataag gaaagctcaa ataacgagca ggacaatagt ctgcttgaac agtatttaac ttcagttcaa cagctggaag atgctgatga gaggaccaat tttgatacag agacaagaga tagcaaactt cacattgctt gtttcccagt acagttagat acattgtctg acggtgcttc tgtagatgag agtcatggca tatctcctcc tttgcaaggt gaaattagcc agacacaaga gaattctaaa ttaaatgcag aagttcaagg gcagcagcca gaatgtgatt ctacatttca gctattgcat gttggtgtta ctgtgtag. It is sometimes possible for the material contained within the vial of "CEP97, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.