Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CEP290 cdna clone

CEP290 cDNA Clone

Gene Names
CEP290; CT87; MKS4; POC3; rd16; BBS14; JBTS5; LCA10; NPHP6; SLSN6; 3H11Ag
Synonyms
CEP290; CEP290 cDNA Clone; CEP290 cdna clone
Ordering
For Research Use Only!
Sequence
atggccattttcaagattgcagctctccaaaaagttgtagataatagtgtttctttgtctgaactagaactggctaataaacagtacaatgaactgactgctaagtacagggacatcttgcaaaaagataatatgcttgttcaaagaacaagtaacttggaacacctggagtgtgaaaacatctccttaaaagaacaagtggagtctataaataaagaactggagattaccaaggaaaaacttcacactattgaacaagcctgggaacaggaaactaaattaggtaatgaatctagcatggataaggcaaagaaatcaataaccaacagtgacattgtttccatttcaaaaaaaataactatgctggaaatgaaggaattaaatgaaaggcagcgggctgaacattgtcaaaaaatgtatgaacacttacggacttcgttaaagcaaatggaggaacgtaattttgaattggaaaccaaatttgctgaggtttga
Sequence Length
495
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
180,067 Da
NCBI Official Full Name
Homo sapiens centrosomal protein 290kDa, mRNA
NCBI Official Synonym Full Names
centrosomal protein 290
NCBI Official Symbol
CEP290
NCBI Official Synonym Symbols
CT87; MKS4; POC3; rd16; BBS14; JBTS5; LCA10; NPHP6; SLSN6; 3H11Ag
NCBI Protein Information
centrosomal protein of 290 kDa
UniProt Protein Name
Centrosomal protein of 290 kDa
Protein Family
UniProt Gene Name
CEP290
UniProt Synonym Gene Names
BBS14; KIAA0373; NPHP6; Cep290; CT87
UniProt Entry Name
CE290_HUMAN

NCBI Description

This gene encodes a protein with 13 putative coiled-coil domains, a region with homology to SMC chromosome segregation ATPases, six KID motifs, three tropomyosin homology domains and an ATP/GTP binding site motif A. The protein is localized to the centrosome and cilia and has sites for N-glycosylation, tyrosine sulfation, phosphorylation, N-myristoylation, and amidation. Mutations in this gene have been associated with Joubert syndrome and nephronophthisis and the presence of antibodies against this protein is associated with several forms of cancer. [provided by RefSeq, Jul 2008]

Uniprot Description

CEP290: Part of the tectonic-like complex which is required for tissue-specific ciliogenesis and may regulate ciliary membrane composition. Activates ATF4-mediated transcription. Required for the correct localization of ciliary and phototransduction proteins in retinal photoreceptor cells; may play a role in ciliary transport processes. Defects in CEP290 are a cause of Joubert syndrome type 5 (JBTS5). Joubert syndrome is an autosomal recessive disease characterized by cerebellar vermis hypoplasia with prominent superior cerebellar peduncles (the 'molar tooth sign' on axial magnetic resonance imaging), psychomotor delay, hypotonia, ataxia, oculomotor apraxia and neonatal breathing abnormalities. JBTS5 shares the neurologic and neuroradiologic features of Joubert syndrome together with severe retinal dystrophy and/or progressive renal failure characterized by nephronophthisis. Defects in CEP290 are a cause of Senior-Loken syndrome type 6 (SLSN6). Senior-Loken syndrome is also known as juvenile nephronophthisis with Leber amaurosis. It is an autosomal recessive renal-retinal disorder, characterized by progressive wasting of the filtering unit of the kidney, with or without medullary cystic renal disease, and progressive eye disease. Defects in CEP290 are the cause of Leber congenital amaurosis type 10 (LCA10). LCA designates a clinically and genetically heterogeneous group of childhood retinal degenerations, generally inherited in an autosomal recessive manner. Affected infants have little or no retinal photoreceptor function as tested by electroretinography. LCA represents the most common genetic cause of congenital visual impairment in infants and children. Defects in CEP290 are the cause of Meckel syndrome type 4 (MKS4). MKS4 is an autosomal recessive disorder characterized by a combination of renal cysts and variably associated features including developmental anomalies of the central nervous system (typically encephalocele), hepatic ductal dysplasia and cysts, and polydactyly. Antibodies against CEP290 are present in sera from patients with cutaneous T-cell lymphomas, but not in the healthy control population. Defects in CEP290 are the cause of Bardet-Biedl syndrome type 14 (BBS14). A syndrome characterized by usually severe pigmentary retinopathy, early-onset obesity, polydactyly, hypogenitalism, renal malformation and mental retardation. Secondary features include diabetes mellitus, hypertension and congenital heart disease. Inheritance is autosomal recessive, but three mutated alleles (two at one locus, and a third at a second locus) may be required for disease manifestation in some cases (triallelic inheritance). 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Cancer Testis Antigen (CTA)

Chromosomal Location of Human Ortholog: 12q21.32

Cellular Component: centrosome; cytoplasm; cytosol; gamma-tubulin complex; membrane; nucleus; photoreceptor connecting cilium; protein complex

Molecular Function: identical protein binding; microtubule minus-end binding; protein binding

Biological Process: cilium biogenesis; eye photoreceptor cell development; G2/M transition of mitotic cell cycle; hindbrain development; otic vesicle formation; positive regulation of transcription, DNA-dependent; pronephros development; protein transport

Disease: Bardet-biedl Syndrome 14; Joubert Syndrome 5; Leber Congenital Amaurosis 10; Meckel Syndrome, Type 4; Senior-loken Syndrome 6

Research Articles on CEP290

Similar Products

Product Notes

The CEP290 cep290 (Catalog #AAA1273363) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccattt tcaagattgc agctctccaa aaagttgtag ataatagtgt ttctttgtct gaactagaac tggctaataa acagtacaat gaactgactg ctaagtacag ggacatcttg caaaaagata atatgcttgt tcaaagaaca agtaacttgg aacacctgga gtgtgaaaac atctccttaa aagaacaagt ggagtctata aataaagaac tggagattac caaggaaaaa cttcacacta ttgaacaagc ctgggaacag gaaactaaat taggtaatga atctagcatg gataaggcaa agaaatcaat aaccaacagt gacattgttt ccatttcaaa aaaaataact atgctggaaa tgaaggaatt aaatgaaagg cagcgggctg aacattgtca aaaaatgtat gaacacttac ggacttcgtt aaagcaaatg gaggaacgta attttgaatt ggaaaccaaa tttgctgagg tttga. It is sometimes possible for the material contained within the vial of "CEP290, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.