Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CENPP cdna clone

CENPP cDNA Clone

Gene Names
CENPP; CENP-P
Synonyms
CENPP; CENPP cDNA Clone; CENPP cdna clone
Ordering
For Research Use Only!
Sequence
atggacgcagagctggcagaggtgcgcgccttgcaagctgagatcgcggccctgcggcgagcgtgtgaggacccaccggcgccctgggaagagaagtcccgagtccaaaaatcttttcaagccatacaccaattcaatttggaaggatggaagtcttcaaaagatctgaaaaatcagcttggacatttagaatcagaactttcatttctaagtacgcttactggcatcaatataagaaatcactccaagcagacagaagacctaacaagcactgagatgacagaaaagagtattagaaaagttctacagagacacagattatcaggaaattgccacatggttacatttcaacttgaatttcagattctggaaattcagaataaggagagattatcttctgctgttactgacctcaacataataatggagcccacagaatgctcagaattaagtgaatttgtgtctagagcagaagagagaaaagatctgttcatgtttttccgaagcctgcatttttttgtggagtggtttgaatatcgtaagcgcacgtttaaacatctcaaggaaaagtacccagatgccgtgtacctctcggaggggccctcctcctgctccatggggatccgcagcgccagccggccagggtttgaattagtcattgtttggaggatacaaatagatgaagatgggaaggtttttccaaagctggatcttctcaccaaagtcccacagcgagccctggagctggacaagaacagagccatagaaactgctcctctcagcttccgaaccctggtaggactgcttggaatcgaagctgctctggaaagcctgataaaatcgctttgtgcagaggagaacaactag
Sequence Length
867
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,707 Da
NCBI Official Full Name
Homo sapiens centromere protein P, mRNA
NCBI Official Synonym Full Names
centromere protein P
NCBI Official Symbol
CENPP
NCBI Official Synonym Symbols
CENP-P
NCBI Protein Information
centromere protein P
UniProt Protein Name
Centromere protein P
Protein Family
UniProt Gene Name
CENPP
UniProt Synonym Gene Names
CENP-P
UniProt Entry Name
CENPP_HUMAN

NCBI Description

CENPP is a subunit of a CENPH (MIM 605607)-CENPI (MIM 300065)-associated centromeric complex that targets CENPA (MIM 117139) to centromeres and is required for proper kinetochore function and mitotic progression (Okada et al., 2006 [PubMed 16622420]).[supplied by OMIM, Mar 2008]

Uniprot Description

CENPP: Component of the CENPA-CAD (nucleosome distal) complex, a complex recruited to centromeres which is involved in assembly of kinetochore proteins, mitotic progression and chromosome segregation. May be involved in incorporation of newly synthesized CENPA into centromeres via its interaction with the CENPA-NAC complex.

Chromosomal Location of Human Ortholog: 9q22.31

Cellular Component: cytosol; nucleolus; nucleoplasm; nucleus

Molecular Function: protein binding

Biological Process: DNA replication-independent nucleosome assembly at centromere; sister chromatid cohesion

Research Articles on CENPP

Similar Products

Product Notes

The CENPP cenpp (Catalog #AAA1272934) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacgcag agctggcaga ggtgcgcgcc ttgcaagctg agatcgcggc cctgcggcga gcgtgtgagg acccaccggc gccctgggaa gagaagtccc gagtccaaaa atcttttcaa gccatacacc aattcaattt ggaaggatgg aagtcttcaa aagatctgaa aaatcagctt ggacatttag aatcagaact ttcatttcta agtacgctta ctggcatcaa tataagaaat cactccaagc agacagaaga cctaacaagc actgagatga cagaaaagag tattagaaaa gttctacaga gacacagatt atcaggaaat tgccacatgg ttacatttca acttgaattt cagattctgg aaattcagaa taaggagaga ttatcttctg ctgttactga cctcaacata ataatggagc ccacagaatg ctcagaatta agtgaatttg tgtctagagc agaagagaga aaagatctgt tcatgttttt ccgaagcctg catttttttg tggagtggtt tgaatatcgt aagcgcacgt ttaaacatct caaggaaaag tacccagatg ccgtgtacct ctcggagggg ccctcctcct gctccatggg gatccgcagc gccagccggc cagggtttga attagtcatt gtttggagga tacaaataga tgaagatggg aaggtttttc caaagctgga tcttctcacc aaagtcccac agcgagccct ggagctggac aagaacagag ccatagaaac tgctcctctc agcttccgaa ccctggtagg actgcttgga atcgaagctg ctctggaaag cctgataaaa tcgctttgtg cagaggagaa caactag. It is sometimes possible for the material contained within the vial of "CENPP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.