Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CENPN cdna clone

CENPN cDNA Clone

Gene Names
CENPN; BM039; CENP-N; ICEN32; C16orf60
Synonyms
CENPN; CENPN cDNA Clone; CENPN cdna clone
Ordering
For Research Use Only!
Sequence
atggatgagactgttgctgagttcatcaagaggaccatcttgaaaatccccatgaatgaactgacaacaatcctgaaggcctgggattttttgtctgaaaatcaactgcagactgtaaatttccgacagagaaaggaatctgtagttcagcacttgatccatctgtgtgaggaaaagcgtgcaagtatcagtgatgctgccctgttagacatcatttatatgcaatttcatcagcaccagaaagtttgggatgtttttcagatgagtaaaggaccaggtgaagatgttgacctttttgatatgaaacaatttaaaaattcgttcaagaaaattcttcagagagcattaaaaaatgtgacagtcagcttcagagaaactgaggagaatgcagtctggattcgaattgcctggggaacacagtacacaaagccaaaccagtacaaacctacctacgtggtgtactactcccagactccgtacgccttcacgtcctcctccatgctgaggcgcaatacaccgcttctgggtcaggcgctgacaattgctagcaaacaccatcagattgtgaaaatggacctgagaagtcggtatctggactctcttaaggctattgtttttaaacagtataatcagacctttgaaactcacaactctacgacacctctacaggaaagaagccttggactagatataaatatggattcaaggatcattcatgaaaacatagtagaaaaagagagagtccaacgaataactcaagaaacatttggagattatcctcaaccacaactagaatttgcacaatataagcttgaaacgaaattcaaaagtggtttaaatgggagcatcttggctgagagggaagaacccctccgatgcctaataaagttctctagcccacatcttctggaagcattgaaatccttagcaccagcgggtattgcagatgctccactttctccactgctcacttgcatacccaacaagagaatgaattattttaaaattagagataaat
Sequence Length
1018
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,556 Da
NCBI Official Full Name
Homo sapiens centromere protein N, mRNA
NCBI Official Synonym Full Names
centromere protein N
NCBI Official Symbol
CENPN
NCBI Official Synonym Symbols
BM039; CENP-N; ICEN32; C16orf60
NCBI Protein Information
centromere protein N
UniProt Protein Name
Centromere protein N
Protein Family
UniProt Gene Name
CENPN
UniProt Synonym Gene Names
C16orf60; ICEN32; CENP-N
UniProt Entry Name
CENPN_HUMAN

NCBI Description

The protein encoded by this gene forms part of the nucleosome-associated complex and is important for kinetochore assembly. It is bound to kinetochores during S phase and G2 and recruits other proteins to the centromere. Pseudogenes of this gene are located on chromosome 2. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]

Uniprot Description

CENPN: Component of the CENPA-NAC (nucleosome-associated) complex, a complex that plays a central role in assembly of kinetochore proteins, mitotic progression and chromosome segregation. The CENPA-NAC complex recruits the CENPA-CAD (nucleosome distal) complex and may be involved in incorporation of newly synthesized CENPA into centromeres. CENPN is the first protein to bind specifically to CENPA nucleosomes and the direct binding of CENPA nucleosomes by CENPN is required for centromere assembly. Required for chromosome congression and efficiently align the chromosomes on a metaphase plate. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 16q23.2

Cellular Component: cytosol; nucleoplasm

Biological Process: DNA replication-independent nucleosome assembly at centromere; sister chromatid cohesion

Research Articles on CENPN

Similar Products

Product Notes

The CENPN cenpn (Catalog #AAA1276907) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatgaga ctgttgctga gttcatcaag aggaccatct tgaaaatccc catgaatgaa ctgacaacaa tcctgaaggc ctgggatttt ttgtctgaaa atcaactgca gactgtaaat ttccgacaga gaaaggaatc tgtagttcag cacttgatcc atctgtgtga ggaaaagcgt gcaagtatca gtgatgctgc cctgttagac atcatttata tgcaatttca tcagcaccag aaagtttggg atgtttttca gatgagtaaa ggaccaggtg aagatgttga cctttttgat atgaaacaat ttaaaaattc gttcaagaaa attcttcaga gagcattaaa aaatgtgaca gtcagcttca gagaaactga ggagaatgca gtctggattc gaattgcctg gggaacacag tacacaaagc caaaccagta caaacctacc tacgtggtgt actactccca gactccgtac gccttcacgt cctcctccat gctgaggcgc aatacaccgc ttctgggtca ggcgctgaca attgctagca aacaccatca gattgtgaaa atggacctga gaagtcggta tctggactct cttaaggcta ttgtttttaa acagtataat cagacctttg aaactcacaa ctctacgaca cctctacagg aaagaagcct tggactagat ataaatatgg attcaaggat cattcatgaa aacatagtag aaaaagagag agtccaacga ataactcaag aaacatttgg agattatcct caaccacaac tagaatttgc acaatataag cttgaaacga aattcaaaag tggtttaaat gggagcatct tggctgagag ggaagaaccc ctccgatgcc taataaagtt ctctagccca catcttctgg aagcattgaa atccttagca ccagcgggta ttgcagatgc tccactttct ccactgctca cttgcatacc caacaagaga atgaattatt ttaaaattag agataaat. It is sometimes possible for the material contained within the vial of "CENPN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.