Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CENPA cdna clone

CENPA cDNA Clone

Gene Names
CENPA; CenH3; CENP-A
Synonyms
CENPA; CENPA cDNA Clone; CENPA cdna clone
Ordering
For Research Use Only!
Sequence
atgggcccgcgccgccggagccgaaagcccgaggccccgaggaggcgcagcccgagcccgaccccgacccccggcccctcccggcggggcccctccttaggcgcttcctcccatcaacacagtcggcggagacaaggttggctaaaggagatccgaaagcttcagaagagcacacacctcttgataaggaagctgcccttcagccgcctggcaagagaaatatgtgttaaattcactcgtggtgtggacttcaattggcaagcccaggccctattggccctacaagaggcagcagaagcatttctagttcatctctttgaggacgcctatctcctcaccttacatgcaggccgagttactctcttcccaaaggatgtgcaactggcccggaggatccggggccttgaggagggactcggctga
Sequence Length
423
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,001 Da
NCBI Official Full Name
Homo sapiens centromere protein A, mRNA
NCBI Official Synonym Full Names
centromere protein A
NCBI Official Symbol
CENPA
NCBI Official Synonym Symbols
CenH3; CENP-A
NCBI Protein Information
histone H3-like centromeric protein A
UniProt Protein Name
Histone H3-like centromeric protein A
UniProt Gene Name
CENPA
UniProt Synonym Gene Names
CENP-A
UniProt Entry Name
CENPA_HUMAN

NCBI Description

Centromeres are the differentiated chromosomal domains that specify the mitotic behavior of chromosomes. This gene encodes a centromere protein which contains a histone H3 related histone fold domain that is required for targeting to the centromere. Centromere protein A is proposed to be a component of a modified nucleosome or nucleosome-like structure in which it replaces 1 or both copies of conventional histone H3 in the (H3-H4)2 tetrameric core of the nucleosome particle. The protein is a replication-independent histone that is a member of the histone H3 family. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2015]

Uniprot Description

CENPA: a basic nuclear protein of the histone H3 family. May act as a core histone necessary for the assembly of centromeres. Contains a histone H3 related histone fold domain that is required for targeting to the centromere. CENPA is proposed to be a component of a modified nucleosome or nucleosome-like structure in which it replaces 1 or both copies of conventional histone H3 in the (H3-H4)2 tetrameric core of the nucleosome particle.

Protein type: DNA-binding

Chromosomal Location of Human Ortholog: 2p23.3

Cellular Component: chromosome, pericentric region; condensed nuclear chromosome, pericentric region; cytosol; nucleoplasm; nucleus

Molecular Function: chromatin binding; protein binding

Biological Process: DNA replication-independent nucleosome assembly at centromere; establishment of mitotic spindle orientation; kinetochore assembly; sister chromatid cohesion

Research Articles on CENPA

Similar Products

Product Notes

The CENPA cenpa (Catalog #AAA1267017) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcccgc gccgccggag ccgaaagccc gaggccccga ggaggcgcag cccgagcccg accccgaccc ccggcccctc ccggcggggc ccctccttag gcgcttcctc ccatcaacac agtcggcgga gacaaggttg gctaaaggag atccgaaagc ttcagaagag cacacacctc ttgataagga agctgccctt cagccgcctg gcaagagaaa tatgtgttaa attcactcgt ggtgtggact tcaattggca agcccaggcc ctattggccc tacaagaggc agcagaagca tttctagttc atctctttga ggacgcctat ctcctcacct tacatgcagg ccgagttact ctcttcccaa aggatgtgca actggcccgg aggatccggg gccttgagga gggactcggc tga. It is sometimes possible for the material contained within the vial of "CENPA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.