Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDK9 cdna clone

CDK9 cDNA Clone

Gene Names
CDK9; TAK; C-2k; CTK1; CDC2L4; PITALRE
Synonyms
CDK9; CDK9 cDNA Clone; CDK9 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgaagcagtacgactcggtggagtgccctttttgtgatgaagtttccaaatacgagaagctcgccaagatcggccaaggcaccttcggggaggtgttcaaggccaggcaccgcaagaccggccagaaggtggctctgaagaaggtgctgatggaaaacgagaaggaggggttccccattacagccttgcgggagatcaagatccttcagcttctaaaacacgagaatgtggtcaacttgattgagatttgtcgaaccaaagcttccccctataaccgctgcaagggtagtatatacctggtgttcgacttctgcgagcatgaccttgctgggctgttgagcaatgttttggtcaagttcacgctgtctgagatcaagagggtgatgcagatgctgcttaacggcctctactacatccacagaaacaagatcctgcatagggacatgaaggctgctaatgtgcttatcactcgtgatggggtcctgaagctggcagactttgggctggcccgggccttcagcctggccaagaacagccagcccaaccgctacaccaaccgtgtggtgacactctggtaccggcccccggagctgttgctcggggagcgggactacggcccccccattgacctgtggggtgctgggtgcatcatggcagagatgtggacccgcagccccatcatgcagggcaacacggagcagcaccaactcgccctcatcagtcagctctgcggctccatcacccctgaggtgtggccaaacgtggacaactatgagctgtacgaaaagctggagctggtcaagggccagaagcggaaggtgaaggacaggctgaaggcctatgtgcgtgacccatacgcactggacctcatcgacaagctgctggtgctggaccctgcccagcgcatcgacagcgatgacgccctcaaccacgacttcttctggtccgaccccatgccctccgacctcaagggcatgctctccacccacctgacgtccatgttcgagtacttggcaccaccgcgccggaagggcagccagatcacccagcagtccaccaaccagagtcgcaatcccgccaccaccaaccagacggagtttgagcgcgtcttctga
Sequence Length
1119
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,365 Da
NCBI Official Full Name
Homo sapiens cyclin-dependent kinase 9, mRNA
NCBI Official Synonym Full Names
cyclin dependent kinase 9
NCBI Official Symbol
CDK9
NCBI Official Synonym Symbols
TAK; C-2k; CTK1; CDC2L4; PITALRE
NCBI Protein Information
cyclin-dependent kinase 9
UniProt Protein Name
Cyclin-dependent kinase 9
Protein Family
UniProt Gene Name
CDK9
UniProt Synonym Gene Names
CDC2L4; TAK
UniProt Entry Name
CDK9_HUMAN

NCBI Description

The protein encoded by this gene is a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, and known as important cell cycle regulators. This kinase was found to be a component of the multiprotein complex TAK/P-TEFb, which is an elongation factor for RNA polymerase II-directed transcription and functions by phosphorylating the C-terminal domain of the largest subunit of RNA polymerase II. This protein forms a complex with and is regulated by its regulatory subunit cyclin T or cyclin K. HIV-1 Tat protein was found to interact with this protein and cyclin T, which suggested a possible involvement of this protein in AIDS. [provided by RefSeq, Jul 2008]

Uniprot Description

CDK9: a protein kinase of the CDK family. Forms a complex with and is regulated by its regulatory subunit cyclin T or cyclin K. A component of the multiprotein complex TAK/P-TEFb, which is an elongation factor for RNA polymerase II-directed transcription and functions by phosphorylating the C-terminal domain of the largest subunit of RNA polymerase II. Transcriptional elongation factor and cofactor for HIV Tat protein; RNAi blocks HIV replication, and inhibitors also block varicella zoster replication. Mediates signals leading to cardiac hypertrophy. Inhibitor: Flavopiridol.

Protein type: EC 2.7.11.22; Cell cycle regulation; Protein kinase, CMGC; EC 2.7.11.23; Protein kinase, Ser/Thr (non-receptor); Kinase, protein; Nuclear receptor co-regulator; CMGC group; CDK family; CDK/CDK9 subfamily; CDK9 subfamily

Chromosomal Location of Human Ortholog: 9q34.1

Cellular Component: intracellular membrane-bound organelle; membrane; nucleoplasm; PML body; transcription elongation factor complex; transcription elongation factor complex b

Molecular Function: chromatin binding; cyclin-dependent protein kinase activity; DNA binding; kinase activity; protein binding; protein kinase activity; protein serine/threonine kinase activity; RNA polymerase subunit kinase activity

Biological Process: cell proliferation; positive regulation of histone phosphorylation; positive regulation of transcription from RNA polymerase II promoter; positive regulation of viral transcription; protein amino acid phosphorylation; regulation of DNA repair; regulation of histone modification; regulation of mitotic cell cycle; regulation of muscle cell differentiation; replication fork processing; RNA elongation from RNA polymerase II promoter; snRNA transcription from RNA polymerase II promoter; transcription from RNA polymerase II promoter; transcription initiation from RNA polymerase II promoter

Research Articles on CDK9

Similar Products

Product Notes

The CDK9 cdk9 (Catalog #AAA1278259) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgaagc agtacgactc ggtggagtgc cctttttgtg atgaagtttc caaatacgag aagctcgcca agatcggcca aggcaccttc ggggaggtgt tcaaggccag gcaccgcaag accggccaga aggtggctct gaagaaggtg ctgatggaaa acgagaagga ggggttcccc attacagcct tgcgggagat caagatcctt cagcttctaa aacacgagaa tgtggtcaac ttgattgaga tttgtcgaac caaagcttcc ccctataacc gctgcaaggg tagtatatac ctggtgttcg acttctgcga gcatgacctt gctgggctgt tgagcaatgt tttggtcaag ttcacgctgt ctgagatcaa gagggtgatg cagatgctgc ttaacggcct ctactacatc cacagaaaca agatcctgca tagggacatg aaggctgcta atgtgcttat cactcgtgat ggggtcctga agctggcaga ctttgggctg gcccgggcct tcagcctggc caagaacagc cagcccaacc gctacaccaa ccgtgtggtg acactctggt accggccccc ggagctgttg ctcggggagc gggactacgg cccccccatt gacctgtggg gtgctgggtg catcatggca gagatgtgga cccgcagccc catcatgcag ggcaacacgg agcagcacca actcgccctc atcagtcagc tctgcggctc catcacccct gaggtgtggc caaacgtgga caactatgag ctgtacgaaa agctggagct ggtcaagggc cagaagcgga aggtgaagga caggctgaag gcctatgtgc gtgacccata cgcactggac ctcatcgaca agctgctggt gctggaccct gcccagcgca tcgacagcga tgacgccctc aaccacgact tcttctggtc cgaccccatg ccctccgacc tcaagggcat gctctccacc cacctgacgt ccatgttcga gtacttggca ccaccgcgcc ggaagggcag ccagatcacc cagcagtcca ccaaccagag tcgcaatccc gccaccacca accagacgga gtttgagcgc gtcttctga. It is sometimes possible for the material contained within the vial of "CDK9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.