Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDK7 cdna clone

CDK7 cDNA Clone

Gene Names
CDK7; CAK; CAK1; HCAK; MO15; STK1; CDKN7; p39MO15
Synonyms
CDK7; CDK7 cDNA Clone; CDK7 cdna clone
Ordering
For Research Use Only!
Sequence
atggctctggacgtgaagtctcgggcaaagcgttatgagaagctggacttccttggggagggacagtttgccaccgtttacaaggccagagataagaacaccaaccaaattgtcgccattaagaaaatcaaacttggacatagatcagaagctaaagatggtataaatagaaccgccttaagagagataaaattattacaggagctaagtcatccaaatataattggtctccttgatgcttttggacataaatctaatattagccttgtctttgattttatggaaactgatctagaggttataataaaggataatagtcttgtgctgacaccatcacacatcaaagcctacatgttgatgactcttcaaggattagaatatttacatcaacattggatcctacatagggatctgaaaccaaacaacttgttgctagatgaaaatggagttctaaaactggcagattttggcctggccaaatcttttgggagccccaatagagcttatacacatcaggttgtaaccaggtggtatcgggcccccgagttactatttggagctaggatgtatggtgtaggtgtggacatgtgggctgttggctgtatattagcagagttacttctaagggttccttttttgccaggagattcagaccttgatcagctaacaagaatatttgaaactttgggcacaccaactgaggaacagtggccggacatgtgtagtcttccagattatgtgacatttaagagtttccctggaatacctttgcatcacatcttcagtgcagcaggagacgacttactagatctcatacaaggcttattcttatttaatccatgtgctcgaattacggccacacaggcactgaaaatgaagtatttcagtaatcggccagggccaacacctggatgtcagctgccaagaccaaactgtccagtggaaaccttaaaggagcaatcaaatccagctttggcaataaaaaggaaaagaacagaggccttagaacaaggaggattgcccaagaaactaattttttaa
Sequence Length
1041
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,038 Da
NCBI Official Full Name
Homo sapiens cyclin-dependent kinase 7, mRNA
NCBI Official Synonym Full Names
cyclin dependent kinase 7
NCBI Official Symbol
CDK7
NCBI Official Synonym Symbols
CAK; CAK1; HCAK; MO15; STK1; CDKN7; p39MO15
NCBI Protein Information
cyclin-dependent kinase 7
UniProt Protein Name
Cyclin-dependent kinase 7
Protein Family
UniProt Gene Name
CDK7
UniProt Synonym Gene Names
CAK; CAK1; CDKN7; MO15; STK1; p39 Mo15
UniProt Entry Name
CDK7_HUMAN

NCBI Description

The protein encoded by this gene is a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe cdc2, and are known to be important regulators of cell cycle progression. This protein forms a trimeric complex with cyclin H and MAT1, which functions as a Cdk-activating kinase (CAK). It is an essential component of the transcription factor TFIIH, that is involved in transcription initiation and DNA repair. This protein is thought to serve as a direct link between the regulation of transcription and the cell cycle. [provided by RefSeq, Jul 2008]

Uniprot Description

CDK7: a protein kinase of the CDK family. Forms a trimeric complex with cyclin H and MAT1, which functions as a Cdk-activating kinase (CAK). Activates the cyclin-associated kinases CDK1, -2, -4 and -6. An essential component of the transcription factor TFIIH, that is involved in transcription initiation and DNA repair. Serves as a direct link between the regulation of transcription and the cell cycle. Phosphorylates and activates RNA polymerase II, allowing its escape from the promoter and elongation of the transcripts. Involved in cell cycle control and in RNA transcription by RNA polymerase II. Its expression and activity are constant throughout the cell cycle.

Protein type: Kinase, protein; EC 2.7.11.22; Cell cycle regulation; Protein kinase, Ser/Thr (non-receptor); EC 2.7.11.23; Protein kinase, CMGC; Nuclear receptor co-regulator; CMGC group; CDK family; CDK7 subfamily; CDK/CDK7 subfamily

Chromosomal Location of Human Ortholog: 5q12.1

Cellular Component: cytoplasm; holo TFIIH complex; mitochondrion; nucleoplasm; nucleus

Molecular Function: DNA-dependent ATPase activity; kinase activity; protein binding; protein C-terminus binding; protein kinase activity; protein serine/threonine kinase activity; RNA polymerase subunit kinase activity

Biological Process: cell cycle arrest; cell proliferation; G1/S transition of mitotic cell cycle; G2/M transition of mitotic cell cycle; mRNA capping; nucleotide-excision repair, preincision complex assembly; positive regulation of transcription from RNA polymerase II promoter; regulation of cyclin-dependent protein kinase activity; RNA elongation from RNA polymerase I promoter; RNA elongation from RNA polymerase II promoter; snRNA transcription from RNA polymerase II promoter; termination of RNA polymerase I transcription; transcription from RNA polymerase II promoter; transcription initiation from RNA polymerase I promoter; transcription initiation from RNA polymerase II promoter; transcription-coupled nucleotide-excision repair

Research Articles on CDK7

Similar Products

Product Notes

The CDK7 cdk7 (Catalog #AAA1268000) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctctgg acgtgaagtc tcgggcaaag cgttatgaga agctggactt ccttggggag ggacagtttg ccaccgttta caaggccaga gataagaaca ccaaccaaat tgtcgccatt aagaaaatca aacttggaca tagatcagaa gctaaagatg gtataaatag aaccgcctta agagagataa aattattaca ggagctaagt catccaaata taattggtct ccttgatgct tttggacata aatctaatat tagccttgtc tttgatttta tggaaactga tctagaggtt ataataaagg ataatagtct tgtgctgaca ccatcacaca tcaaagccta catgttgatg actcttcaag gattagaata tttacatcaa cattggatcc tacataggga tctgaaacca aacaacttgt tgctagatga aaatggagtt ctaaaactgg cagattttgg cctggccaaa tcttttggga gccccaatag agcttataca catcaggttg taaccaggtg gtatcgggcc cccgagttac tatttggagc taggatgtat ggtgtaggtg tggacatgtg ggctgttggc tgtatattag cagagttact tctaagggtt ccttttttgc caggagattc agaccttgat cagctaacaa gaatatttga aactttgggc acaccaactg aggaacagtg gccggacatg tgtagtcttc cagattatgt gacatttaag agtttccctg gaataccttt gcatcacatc ttcagtgcag caggagacga cttactagat ctcatacaag gcttattctt atttaatcca tgtgctcgaa ttacggccac acaggcactg aaaatgaagt atttcagtaa tcggccaggg ccaacacctg gatgtcagct gccaagacca aactgtccag tggaaacctt aaaggagcaa tcaaatccag ctttggcaat aaaaaggaaa agaacagagg ccttagaaca aggaggattg cccaagaaac taatttttta a. It is sometimes possible for the material contained within the vial of "CDK7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.