Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDCA5 cdna clone

CDCA5 cDNA Clone

Gene Names
CDCA5; SORORIN
Synonyms
CDCA5; CDCA5 cDNA Clone; CDCA5 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctgggaggcgaacgcggtccggaggagccgctcagcgctccgggccaagggccccatctcctactaagcctctgcggaggtcccagcggaaatcaggctctgaactcccgagcatcctccctgaaatctggccgaagacacccagtgcggctgcagtcagaaagcccatcgtcttaaagaggatcgtggcccatgctgtagaggtcccagctgtccaatcacctcgcaggagccctaggatttcctttttcttggagaaagaaaacgagccccctggcagggagcttactaaggaggaccttttcaagacacacagcgtccctgccacccccaccagcactcctgtgccgaaccctgaggccgagtccagctccaaggaaggagagctggacgccagagacttggaaatgtctaagaaagtcaggcgttcctacagccggctggagaccctgggctctgcctctacctccaccccaggccgccggtcctgctttggcttcgaggggctgctgggggcagaagacttgtccggagtctcgccagtggtgtgctccaaactcaccgaggtccccagggtttgtgcaaagccctgggccccagacatgactctccctggaatctccccaccacccgagaaacagaaacgtaagaagaagaaaatgccagagatcttgaaaacggagctggatgagtgggctgcggccatgaatgccgagtttgaagctgctgagcagtttgatctcctggttgaatga
Sequence Length
759
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,601 Da
NCBI Official Full Name
Homo sapiens cell division cycle associated 5, mRNA
NCBI Official Synonym Full Names
cell division cycle associated 5
NCBI Official Symbol
CDCA5
NCBI Official Synonym Symbols
SORORIN
NCBI Protein Information
sororin
UniProt Protein Name
Sororin
Protein Family
UniProt Gene Name
CDCA5
UniProt Entry Name
CDCA5_HUMAN

Uniprot Description

CDCA5: Regulator of sister chromatid cohesion in mitosis stabilizing cohesin complex association with chromatin. May antagonize the action of WAPAL which stimulates cohesin dissociation from chromatin. Cohesion ensures that chromosome partitioning is accurate in both meiotic and mitotic cells and plays an important role in DNA repair. Required for efficient DNA double-stranded break repair. Belongs to the sororin family.

Protein type: Cell cycle regulation

Chromosomal Location of Human Ortholog: 11q12.1

Cellular Component: chromosome; chromosome, pericentric region; cohesin complex; cytoplasm; cytosol; nuclear chromatin; nucleoplasm; nucleus; plasma membrane

Molecular Function: chromatin binding; protein binding

Biological Process: double-strand break repair; G1/S transition of mitotic cell cycle; mitosis; mitotic chromosome condensation; mitotic metaphase plate congression; mitotic sister chromatid cohesion; positive regulation of exit from mitosis; sister chromatid cohesion

Research Articles on CDCA5

Similar Products

Product Notes

The CDCA5 cdca5 (Catalog #AAA1278791) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctggga ggcgaacgcg gtccggagga gccgctcagc gctccgggcc aagggcccca tctcctacta agcctctgcg gaggtcccag cggaaatcag gctctgaact cccgagcatc ctccctgaaa tctggccgaa gacacccagt gcggctgcag tcagaaagcc catcgtctta aagaggatcg tggcccatgc tgtagaggtc ccagctgtcc aatcacctcg caggagccct aggatttcct ttttcttgga gaaagaaaac gagccccctg gcagggagct tactaaggag gaccttttca agacacacag cgtccctgcc acccccacca gcactcctgt gccgaaccct gaggccgagt ccagctccaa ggaaggagag ctggacgcca gagacttgga aatgtctaag aaagtcaggc gttcctacag ccggctggag accctgggct ctgcctctac ctccacccca ggccgccggt cctgctttgg cttcgagggg ctgctggggg cagaagactt gtccggagtc tcgccagtgg tgtgctccaa actcaccgag gtccccaggg tttgtgcaaa gccctgggcc ccagacatga ctctccctgg aatctcccca ccacccgaga aacagaaacg taagaagaag aaaatgccag agatcttgaa aacggagctg gatgagtggg ctgcggccat gaatgccgag tttgaagctg ctgagcagtt tgatctcctg gttgaatga. It is sometimes possible for the material contained within the vial of "CDCA5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.