Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDC73 cdna clone

CDC73 cDNA Clone

Gene Names
CDC73; HYX; FIHP; HPTJT; HRPT1; HRPT2; C1orf28
Synonyms
CDC73; CDC73 cDNA Clone; CDC73 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggacgtgcttagcgtcctgcgacagtacaacatccagaagaaggagattgtggtgaagggagacgaagtgatcttcggggagttctcctggcccaagaatgtgaagaccaactatgttgtttgggggactggaaaggaaggccaacccagagagtactacacattggattccattttatttctacttaataacgtgcacctttctcatcctgtttatgtccgacgtgcagctactgaaaatattcctgtggttagaagacctgatcgaaaagatctacttggatatctcaatggtgaagcgtcaacatcggcaagtatagacagaagcgctcccttagaaataggtcttcagcgatctactcaagtcaaacgagctgcagatgaagttttagcagaagcaaagaaaccacgaattgaggatgaagagtgtgtgcgccttgataaagagagattggctgcccgtttggagggtcacaaagaagggattgtacagactgaacagattaggtctttgtctgaagctatgtcagtggaaaaaattgctgcaatcaaagccaaaattatggctaagaaaagatctactatcaagactgatctagatgatgacataactgcccttaaacagaggagttttgtggatgctgaggtagatgtgacccgagatattgtcagcagagagagagtatggaggacacgaacaactatcttacaaagcacaggaaagaatttttccaagaacatttttgcaattcttcaatctgtaaaagccagagaagaagggcgtgcacctgaacagcgacctgccccaaatgcagcacctgtggatcccactttgcgcaccaaacagcctatcccagctgcctataacagatacgatcaggaaagattcaaaggaaaagaagaaacggaaggcttcaaaattgacactatgggaacctaccatggtatgacactgaaatctgtaacggagggtgcatctgcccggaagactcagactcctgcagcccagccagtaccaagaccagtttctcaagcaagacctcccccaaatcagaagaaaggatctcgaacacccattatcataattcctgcagctaccacctctttaataaccatgcttaatgcaaaagaccttctacaggacctgaaatttgtcccatcagatgaaaagaagaaacaaggttgtcaacgagaaaatgaaactctaatacaaagaagaaaagaccagatgcaaccagggggcactgcaattagtgttacagtaccttatagagtagtagaccagccccttaaacttatgcctcaagactgggaccgcgttgtagccgtttttgtgcagggtcctgcatggcagttcaaaggttggccatggcttttgcctgatggatcaccagttgatatatttgctaaaattaaagccttccatctgaagtatgatgaagttcgtctggatccaaatgttcagaaatgggatgtaacagtattagaactcagctatcacaaacgtcatttggatagaccagtgttcttacggttttgggaaacattggacaggtacatggtaaagcataaatcgcacttgagattctga
Sequence Length
1596
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,577 Da
NCBI Official Full Name
Homo sapiens cell division cycle 73, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
cell division cycle 73
NCBI Official Symbol
CDC73
NCBI Official Synonym Symbols
HYX; FIHP; HPTJT; HRPT1; HRPT2; C1orf28
NCBI Protein Information
parafibromin
UniProt Protein Name
Parafibromin
UniProt Gene Name
CDC73
UniProt Synonym Gene Names
C1orf28; HRPT2
UniProt Entry Name
CDC73_HUMAN

NCBI Description

This gene encodes a tumor suppressor that is involved in transcriptional and post-transcriptional control pathways. The protein is a component of the the PAF protein complex, which associates with the RNA polymerase II subunit POLR2A and with a histone methyltransferase complex. This protein appears to facilitate the association of 3' mRNA processing factors with actively-transcribed chromatin. Mutations in this gene have been linked to hyperparathyroidism-jaw tumor syndrome, familial isolated hyperparathyroidism, and parathyroid carcinoma. [provided by RefSeq, Jul 2009]

Uniprot Description

CDC73: Tumor suppressor probably involved in transcriptional and post-transcriptional control pathways. May be involved in cell cycle progression through the regulation of cyclin D1/PRAD1 expression. Component of the PAF1 complex (PAF1C) which has multiple functions during transcription by RNA polymerase II and is implicated in regulation of development and maintenance of embryonic stem cell pluripotency. PAF1C associates with RNA polymerase II through interaction with POLR2A CTD non- phosphorylated and 'Ser-2'- and 'Ser-5'-phosphorylated forms and is involved in transcriptional elongation, acting both indepentently and synergistically with TCEA1 and in cooperation with the DSIF complex and HTATSF1. PAF1C is required for transcription of Hox and Wnt target genes. PAF1C is involved in hematopoiesis and stimulates transcriptional activity of MLL1; it promotes leukemogenesis though association with MLL-rearranged oncoproteins, such as MLL-MLLT3/AF9 and MLL-MLLT1/ENL. PAF1C is involved in histone modifications such as ubiquitination of histone H2B and methylation on histone H3 'Lys-4' (H3K4me3). PAF1C recruits the RNF20/40 E3 ubiquitin-protein ligase complex and the E2 enzyme UBE2A or UBE2B to chromatin which mediate monoubiquitination of 'Lys-120' of histone H2B (H2BK120ub1); UB2A/B-mediated H2B ubiquitination is proposed to be coupled to transcription. PAF1C is involved in mRNA 3' end formation probably through association with cleavage and poly(A) factors. In case of infection by influenza A strain H3N2, PAF1C associates with viral NS1 protein, thereby regulating gene transcription. Connects PAF1C with the cleavage and polyadenylation specificity factor (CPSF) complex and the cleavage stimulation factor (CSTF) complex, and with Wnt signaling. Involved in polyadenylation of mRNA precursors. Component of the PAF1 complex, which consists of CDC73, PAF1, LEO1, CTR9, RTF1 and WDR61. Interacts with POLR2A, CPSF1, CPSF4, CSTF2, MLL and CTNNB1. Interacts with a Set1-like complex that has histone methyltransferase activity and methylates histone H3. Found in a complex with BCL9L or BCL9, CDC73, CTNNB1 and PYGO1 indicative for the participation in a nuclear Wnt signaling complex. Found in adrenal and parathyroid glands, kidney and heart. Belongs to the CDC73 family.

Protein type: Cell cycle regulation; Tumor suppressor

Chromosomal Location of Human Ortholog: 1q25

Cellular Component: cytoplasm; nuclear chromosome, telomeric region; nucleoplasm; nucleus

Molecular Function: protein binding

Biological Process: endodermal cell fate commitment; histone H2B ubiquitination; histone monoubiquitination; mRNA polyadenylation; negative regulation of cell proliferation; negative regulation of epithelial cell proliferation; negative regulation of fibroblast proliferation; negative regulation of myeloid cell differentiation; negative regulation of transcription from RNA polymerase II promoter; positive regulation of mRNA 3'-end processing; positive regulation of RNA elongation from RNA polymerase II promoter; positive regulation of transcription from RNA polymerase II promoter; positive regulation of Wnt receptor signaling pathway; protein destabilization; stem cell maintenance

Disease: Parathyroid Carcinoma

Research Articles on CDC73

Similar Products

Product Notes

The CDC73 cdc73 (Catalog #AAA1273132) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggacg tgcttagcgt cctgcgacag tacaacatcc agaagaagga gattgtggtg aagggagacg aagtgatctt cggggagttc tcctggccca agaatgtgaa gaccaactat gttgtttggg ggactggaaa ggaaggccaa cccagagagt actacacatt ggattccatt ttatttctac ttaataacgt gcacctttct catcctgttt atgtccgacg tgcagctact gaaaatattc ctgtggttag aagacctgat cgaaaagatc tacttggata tctcaatggt gaagcgtcaa catcggcaag tatagacaga agcgctccct tagaaatagg tcttcagcga tctactcaag tcaaacgagc tgcagatgaa gttttagcag aagcaaagaa accacgaatt gaggatgaag agtgtgtgcg ccttgataaa gagagattgg ctgcccgttt ggagggtcac aaagaaggga ttgtacagac tgaacagatt aggtctttgt ctgaagctat gtcagtggaa aaaattgctg caatcaaagc caaaattatg gctaagaaaa gatctactat caagactgat ctagatgatg acataactgc ccttaaacag aggagttttg tggatgctga ggtagatgtg acccgagata ttgtcagcag agagagagta tggaggacac gaacaactat cttacaaagc acaggaaaga atttttccaa gaacattttt gcaattcttc aatctgtaaa agccagagaa gaagggcgtg cacctgaaca gcgacctgcc ccaaatgcag cacctgtgga tcccactttg cgcaccaaac agcctatccc agctgcctat aacagatacg atcaggaaag attcaaagga aaagaagaaa cggaaggctt caaaattgac actatgggaa cctaccatgg tatgacactg aaatctgtaa cggagggtgc atctgcccgg aagactcaga ctcctgcagc ccagccagta ccaagaccag tttctcaagc aagacctccc ccaaatcaga agaaaggatc tcgaacaccc attatcataa ttcctgcagc taccacctct ttaataacca tgcttaatgc aaaagacctt ctacaggacc tgaaatttgt cccatcagat gaaaagaaga aacaaggttg tcaacgagaa aatgaaactc taatacaaag aagaaaagac cagatgcaac cagggggcac tgcaattagt gttacagtac cttatagagt agtagaccag ccccttaaac ttatgcctca agactgggac cgcgttgtag ccgtttttgt gcagggtcct gcatggcagt tcaaaggttg gccatggctt ttgcctgatg gatcaccagt tgatatattt gctaaaatta aagccttcca tctgaagtat gatgaagttc gtctggatcc aaatgttcag aaatgggatg taacagtatt agaactcagc tatcacaaac gtcatttgga tagaccagtg ttcttacggt tttgggaaac attggacagg tacatggtaa agcataaatc gcacttgaga ttctga. It is sometimes possible for the material contained within the vial of "CDC73, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.