Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDC42EP2 cdna clone

CDC42EP2 cDNA Clone

Synonyms
CDC42EP2; CDC42EP2 cDNA Clone; CDC42EP2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtccaccaaggtgcccatctatctgaagcgtggcagtcgcaagggcaagaaggagaagcttcgggacctgctgtcctcggacatgatcagcccaccgctgggggacttccgccacaccattcatattggcagtggcggcggcagtgacatgtttggcgacatctccttcctgcagggcaagttccacctcctgccggggaccatggtggaggggcctgaagaagatggcaccttcgacctccccttccagttcacccgcaccgccaccgtgtgtgggcgggagctcccggacggcccatcccctctgctcaagaacgccatctccctcccggttatcggtggaccccaggctctcaccctgcccacagcccaggctccacccaagccccctcgcctgcacctggagacccctcagccttccccacaggagggagggagtgtggacatctggaggattccagagactggctcccccaacagtggactgaccccggagtcaggggccgaggagcccttcctgtccaatgccagctccctgctgtccctgcacgtggacctggggccttccatcctggatgatgtcctgcagatcatggatcaggacctggacagcatgcagatccccacatag
Sequence Length
633
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,484 Da
NCBI Official Full Name
Homo sapiens CDC42 effector protein (Rho GTPase binding) 2, mRNA
UniProt Protein Name
Cdc42 effector protein 2
Protein Family
UniProt Gene Name
CDC42EP2
UniProt Synonym Gene Names
BORG1; CEP2
UniProt Entry Name
BORG1_HUMAN

Uniprot Description

CDC42EP2: Probably involved in the organization of the actin cytoskeleton. May act downstream of CDC42 to induce actin filament assembly leading to cell shape changes. Induces pseudopodia formation in fibroblasts in a CDC42-dependent manner. Belongs to the BORG/CEP family.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 11q13

Cellular Component: cytoplasm; cytosol; membrane; microtubule cytoskeleton; plasma membrane

Molecular Function: GTP-Rho binding; GTPase activator activity; protein binding

Biological Process: actin cytoskeleton organization and biogenesis; positive regulation of actin filament polymerization; positive regulation of protein complex assembly; positive regulation of pseudopodium formation; regulation of cell shape; Rho protein signal transduction

Similar Products

Product Notes

The CDC42EP2 cdc42ep2 (Catalog #AAA1268572) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccacca aggtgcccat ctatctgaag cgtggcagtc gcaagggcaa gaaggagaag cttcgggacc tgctgtcctc ggacatgatc agcccaccgc tgggggactt ccgccacacc attcatattg gcagtggcgg cggcagtgac atgtttggcg acatctcctt cctgcagggc aagttccacc tcctgccggg gaccatggtg gaggggcctg aagaagatgg caccttcgac ctccccttcc agttcacccg caccgccacc gtgtgtgggc gggagctccc ggacggccca tcccctctgc tcaagaacgc catctccctc ccggttatcg gtggacccca ggctctcacc ctgcccacag cccaggctcc acccaagccc cctcgcctgc acctggagac ccctcagcct tccccacagg agggagggag tgtggacatc tggaggattc cagagactgg ctcccccaac agtggactga ccccggagtc aggggccgag gagcccttcc tgtccaatgc cagctccctg ctgtccctgc acgtggacct ggggccttcc atcctggatg atgtcctgca gatcatggat caggacctgg acagcatgca gatccccaca tag. It is sometimes possible for the material contained within the vial of "CDC42EP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.