Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CD99 cdna clone

CD99 cDNA Clone

Gene Names
CD99; MIC2; HBA71; MIC2X; MIC2Y; MSK5X
Synonyms
CD99; CD99 cDNA Clone; CD99 cdna clone
Ordering
For Research Use Only!
Sequence
atggcccgcggggctgcgctggcgctgctgctcttcggcctgctgggtgttctggtcgccgccccggatggtggtttcgatttatctgatgcccttcctgacaatgaaaacaagaaacccactgcaatccccaagaaacccagtgctggggatgactttgacttaggagatgctgttgttgatggagaaaatgacgacccacgaccaccgaacccacccaaaccgatgccaaatccaaaccccaaccaccctagttcctccggtagcttttcagatgctgaccttgcggatggcgtttcaggtggagaaggaaaaggaggcagtgatggtggaggcagccacaggaaagaaggggaagaggccgacgccccaggcgtgatccccgggattgtgggggctgtcgtggtcgccgtggctggagccatctctagcttcattgcttaccagaaaaagaagctatgcttcaaagaaaatgcagaacaaggggaggtggacatggagagccaccggaatgccaacgcagagccagctgttcagcgtactcttttagagaaatag
Sequence Length
558
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,128 Da
NCBI Official Full Name
Homo sapiens CD99 molecule, mRNA
NCBI Official Synonym Full Names
CD99 molecule
NCBI Official Symbol
CD99
NCBI Official Synonym Symbols
MIC2; HBA71; MIC2X; MIC2Y; MSK5X
NCBI Protein Information
CD99 antigen
UniProt Protein Name
CD99 antigen
Protein Family
UniProt Gene Name
CD99
UniProt Synonym Gene Names
MIC2; MIC2X; MIC2Y
UniProt Entry Name
CD99_HUMAN

NCBI Description

The protein encoded by this gene is a cell surface glycoprotein involved in leukocyte migration, T-cell adhesion, ganglioside GM1 and transmembrane protein transport, and T-cell death by a caspase-independent pathway. In addition, the encoded protein may have the ability to rearrange the actin cytoskeleton and may also act as an oncosuppressor in osteosarcoma. This gene is found in the pseudoautosomal region of chromosomes X and Y and escapes X-chromosome inactivation. There is a related pseudogene located immediately adjacent to this locus. [provided by RefSeq, Mar 2016]

Uniprot Description

CD99: Involved in T-cell adhesion processes and in spontaneous rosette formation with erythrocytes. Plays a role in a late step of leukocyte extravasation helping leukocytes to overcome the endothelial basement membrane. Acts at the same site as, but independently of, PECAM1. Involved in T-cell adhesion processes. Belongs to the CD99 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: Xp22.32 and Yp11.3

Cellular Component: cytoplasm; focal adhesion; integral to plasma membrane; plasma membrane

Research Articles on CD99

Similar Products

Product Notes

The CD99 cd99 (Catalog #AAA1267892) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccgcg gggctgcgct ggcgctgctg ctcttcggcc tgctgggtgt tctggtcgcc gccccggatg gtggtttcga tttatctgat gcccttcctg acaatgaaaa caagaaaccc actgcaatcc ccaagaaacc cagtgctggg gatgactttg acttaggaga tgctgttgtt gatggagaaa atgacgaccc acgaccaccg aacccaccca aaccgatgcc aaatccaaac cccaaccacc ctagttcctc cggtagcttt tcagatgctg accttgcgga tggcgtttca ggtggagaag gaaaaggagg cagtgatggt ggaggcagcc acaggaaaga aggggaagag gccgacgccc caggcgtgat ccccgggatt gtgggggctg tcgtggtcgc cgtggctgga gccatctcta gcttcattgc ttaccagaaa aagaagctat gcttcaaaga aaatgcagaa caaggggagg tggacatgga gagccaccgg aatgccaacg cagagccagc tgttcagcgt actcttttag agaaatag. It is sometimes possible for the material contained within the vial of "CD99, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.