Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CD38 cdna clone

CD38 cDNA Clone

Gene Names
CD38; ADPRC1; ADPRC 1
Synonyms
CD38; CD38 cDNA Clone; CD38 cdna clone
Ordering
For Research Use Only!
Sequence
atggccaactgcgagttcagcccggtgtccggggacaaaccctgctgccggctctctaggagagcccaactctgtcttggcgtcagtatcctggtcctgatcctcgtcgtggtgctcgcggtggtcgtcccgaggtggcgccagcagtggagcggtccgggcaccaccaagcgctttcccgagaccgtcctggcgcgatgcgtcaagtacactgaaattcatcctgagatgagacatgtagactgccaaagtgtatgggatgctttcaagggtgcatttatttcaaaacatccttgcaacattactgaagaagactatcagccactaatgaagttgggaactcagaccgtaccttgcaacaagattcttctttggagcagaataaaagatctggcccatcagttcacacaggtccagcgggacatgttcaccctggaggacacgctgctaggctaccttgctgatgacctcacatggtgtggtgaattcaacacttccaaaataaactatcaatcttgcccagactggagaaaggactgcagcaacaaccctgtttcagtattctggaaaacggtttcccgcaggtttgcagaagctgcctgtgatgtggtccatgtgatgctcaatggatcccgcagtaaaatctttgacaaaaacagcacttttgggagtgtggaagtccataatttgcaaccagagaaggttcagacactagaggcctgggtgatacatggtggaagagaagattccagagacttatgccaggatcccaccataaaagagctggaatcgattataagcaaaaggaatattcaattttcctgcaagaatatctacagacctgacaagtttcttcagtgtgtgaaaaatcctgaggattcatcttgcacatctgagatctga
Sequence Length
903
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
952
Molecular Weight
13,788 Da
NCBI Official Full Name
Homo sapiens CD38 molecule, mRNA
NCBI Official Synonym Full Names
CD38 molecule
NCBI Official Symbol
CD38
NCBI Official Synonym Symbols
ADPRC1; ADPRC 1
NCBI Protein Information
ADP-ribosyl cyclase/cyclic ADP-ribose hydrolase 1
UniProt Protein Name
ADP-ribosyl cyclase/cyclic ADP-ribose hydrolase 1
UniProt Gene Name
CD38
UniProt Synonym Gene Names
ADPRC 1; cADPr hydrolase 1
UniProt Entry Name
CD38_HUMAN

NCBI Description

The protein encoded by this gene is a non-lineage-restricted, type II transmembrane glycoprotein that synthesizes and hydrolyzes cyclic adenosine 5'-diphosphate-ribose, an intracellular calcium ion mobilizing messenger. The release of soluble protein and the ability of membrane-bound protein to become internalized indicate both extracellular and intracellular functions for the protein. This protein has an N-terminal cytoplasmic tail, a single membrane-spanning domain, and a C-terminal extracellular region with four N-glycosylation sites. Crystal structure analysis demonstrates that the functional molecule is a dimer, with the central portion containing the catalytic site. It is used as a prognostic marker for patients with chronic lymphocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]

Uniprot Description

CD38: Synthesizes cyclic ADP-ribose, a second messenger for glucose-induced insulin secretion. Also has cADPr hydrolase activity. Also moonlights as a receptor in cells of the immune system. Belongs to the ADP-ribosyl cyclase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Cofactor and Vitamin Metabolism - nicotinate and nicotinamide; EC 3.2.2.6; Apoptosis; Cell cycle regulation; Membrane protein, integral; Cell surface; EC 2.4.99.20; Hydrolase; Lyase

Chromosomal Location of Human Ortholog: 4p15

Cellular Component: membrane

Molecular Function: NAD+ nucleosidase activity; phosphorus-oxygen lyase activity

Biological Process: B cell receptor signaling pathway; negative regulation of apoptosis; negative regulation of transcription, DNA-dependent; positive regulation of B cell proliferation; positive regulation of transcription, DNA-dependent; response to drug

Research Articles on CD38

Similar Products

Product Notes

The CD38 cd38 (Catalog #AAA1276999) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccaact gcgagttcag cccggtgtcc ggggacaaac cctgctgccg gctctctagg agagcccaac tctgtcttgg cgtcagtatc ctggtcctga tcctcgtcgt ggtgctcgcg gtggtcgtcc cgaggtggcg ccagcagtgg agcggtccgg gcaccaccaa gcgctttccc gagaccgtcc tggcgcgatg cgtcaagtac actgaaattc atcctgagat gagacatgta gactgccaaa gtgtatggga tgctttcaag ggtgcattta tttcaaaaca tccttgcaac attactgaag aagactatca gccactaatg aagttgggaa ctcagaccgt accttgcaac aagattcttc tttggagcag aataaaagat ctggcccatc agttcacaca ggtccagcgg gacatgttca ccctggagga cacgctgcta ggctaccttg ctgatgacct cacatggtgt ggtgaattca acacttccaa aataaactat caatcttgcc cagactggag aaaggactgc agcaacaacc ctgtttcagt attctggaaa acggtttccc gcaggtttgc agaagctgcc tgtgatgtgg tccatgtgat gctcaatgga tcccgcagta aaatctttga caaaaacagc acttttggga gtgtggaagt ccataatttg caaccagaga aggttcagac actagaggcc tgggtgatac atggtggaag agaagattcc agagacttat gccaggatcc caccataaaa gagctggaat cgattataag caaaaggaat attcaatttt cctgcaagaa tatctacaga cctgacaagt ttcttcagtg tgtgaaaaat cctgaggatt catcttgcac atctgagatc tga. It is sometimes possible for the material contained within the vial of "CD38, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.