Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CD2 cdna clone

CD2 cDNA Clone

Gene Names
CD2; T11; SRBC; LFA-2
Synonyms
CD2; CD2 cDNA Clone; CD2 cdna clone
Ordering
For Research Use Only!
Sequence
atgagctttccatgtaaatttgtagccagcttccttctgattttcaatgtttcttccaaaggtgcagtctccaaagagattacgaatgccttggaaacctggggtgccttgggtcaggacatcaacttggacattcctagttttcaaatgagtgatgatattgacgatataaaatgggaaaaaacttcagacaagaaaaagattgcacaattcagaaaagagaaagagactttcaaggaaaaagatacatataagctatttaaaaatggaactctgaaaattaagcatctgaagaccgatgatcaggatatctacaaggtatcaatatatgatacaaaaggaaaaaatgtgttggaaaaaatatttgatttgaagattcaagagagggtctcaaaaccaaagatctcctggacttgtatcaacacaaccctgacctgtgaggtaatgaatggaactgaccccgaattaaacctgtatcaagatgggaaacatctaaaactttctcagagggtcatcacacacaagtggaccaccagcctgagtgcaaaattcaagtgcacagcagggaacaaagtcagcaaggaatccagtgtcgagcctgtcagctgtccagagaaaggtctggacatctatctcatcattggcatatgtggaggaggcagcctcttgatggtctttgtggcactgctcgttttctatatcaccaaaaggaaaaaacagaggagtcggagaaatgatgaggagctggagacaagagcccacagagtagctactgaagaaaggggccggaagccccaacaaattccagcttcaacccctcagaatccagcaacttcccaacatcctcctccaccacctggtcatcgttcccaggcacctagtcatcgtcccccgcctcctggacaccgtgttcagcaccagcctcagaagaggcctcctgctccgtcgggcacacaagttcaccagcagaaaggcccgcccctccccagacctcgagttcagccaaaacctccccatggggcagcagaaaactcattgtccccttcctctaattaa
Sequence Length
1056
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
914
Molecular Weight
39,448 Da
NCBI Official Full Name
Homo sapiens CD2 molecule, mRNA
NCBI Official Synonym Full Names
CD2 molecule
NCBI Official Symbol
CD2
NCBI Official Synonym Symbols
T11; SRBC; LFA-2
NCBI Protein Information
T-cell surface antigen CD2
UniProt Protein Name
T-cell surface antigen CD2
Protein Family
CD2
UniProt Gene Name
CD2
UniProt Synonym Gene Names
SRBC
UniProt Entry Name
CD2_HUMAN

NCBI Description

The protein encoded by this gene is a surface antigen found on all peripheral blood T-cells. The encoded protein interacts with LFA3 (CD58) on antigen presenting cells to optimize immune recognition. A locus control region (LCR) has been found in the 3' flanking sequence of this gene. [provided by RefSeq, Jun 2016]

Uniprot Description

CD2: CD2 interacts with lymphocyte function-associated antigen (LFA-3) and CD48/BCM1 to mediate adhesion between T-cells and other cell types. CD2 is implicated in the triggering of T- cells, the cytoplasmic domain is implicated in the signaling function.

Protein type: Apoptosis; Cell surface; Membrane protein, integral

Chromosomal Location of Human Ortholog: 1p13.1

Cellular Component: cell surface; external side of plasma membrane; plasma membrane

Molecular Function: protein binding; receptor binding

Biological Process: apoptosis; cell surface receptor linked signal transduction; heterotypic cell-cell adhesion; leukocyte migration; lipid raft polarization; positive regulation of tumor necrosis factor production; T cell activation

Research Articles on CD2

Similar Products

Product Notes

The CD2 cd2 (Catalog #AAA1267904) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagctttc catgtaaatt tgtagccagc ttccttctga ttttcaatgt ttcttccaaa ggtgcagtct ccaaagagat tacgaatgcc ttggaaacct ggggtgcctt gggtcaggac atcaacttgg acattcctag ttttcaaatg agtgatgata ttgacgatat aaaatgggaa aaaacttcag acaagaaaaa gattgcacaa ttcagaaaag agaaagagac tttcaaggaa aaagatacat ataagctatt taaaaatgga actctgaaaa ttaagcatct gaagaccgat gatcaggata tctacaaggt atcaatatat gatacaaaag gaaaaaatgt gttggaaaaa atatttgatt tgaagattca agagagggtc tcaaaaccaa agatctcctg gacttgtatc aacacaaccc tgacctgtga ggtaatgaat ggaactgacc ccgaattaaa cctgtatcaa gatgggaaac atctaaaact ttctcagagg gtcatcacac acaagtggac caccagcctg agtgcaaaat tcaagtgcac agcagggaac aaagtcagca aggaatccag tgtcgagcct gtcagctgtc cagagaaagg tctggacatc tatctcatca ttggcatatg tggaggaggc agcctcttga tggtctttgt ggcactgctc gttttctata tcaccaaaag gaaaaaacag aggagtcgga gaaatgatga ggagctggag acaagagccc acagagtagc tactgaagaa aggggccgga agccccaaca aattccagct tcaacccctc agaatccagc aacttcccaa catcctcctc caccacctgg tcatcgttcc caggcaccta gtcatcgtcc cccgcctcct ggacaccgtg ttcagcacca gcctcagaag aggcctcctg ctccgtcggg cacacaagtt caccagcaga aaggcccgcc cctccccaga cctcgagttc agccaaaacc tccccatggg gcagcagaaa actcattgtc cccttcctct aattaa. It is sometimes possible for the material contained within the vial of "CD2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.