Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CD19 cdna clone

CD19 cDNA Clone

Gene Names
CD19; B4; CVID3
Synonyms
CD19; CD19 cDNA Clone; CD19 cdna clone
Ordering
For Research Use Only!
Sequence
atgccacctcctcgcctcctcttcttcctcctcttcctcacccccatggaagtcaggcccgaggaacctctagtggtgaaggtggaagagggagataacgctgtgctgcagtgcctcaaggggacctcagatggccccactcagcagctgacctggtctcgggagtccccgcttaaacccttcttaaaactcagcctggggctgccaggcctgggaatccacatgaggcccctggccatctggcttttcatcttcaacgtctctcaacagatggggggcttctacctgtgccagccggggcccccctctgagaaggcctggcagcctggctggacagtcaatgtggagggcagcggggagctgttccggtggaatgtttcggacctaggtggcctgggctgtggcctgaagaacaggtcctcagagggccccagctccccttccgggaagctcatgagccccaagctgtatgtgtgggccaaagaccgccctgagatctgggagggagagcctccgtgtctcccaccgagggacagcctgaaccagagcctcagccaggacctcaccatggcccctggctccacactctggctgtcctgtggggtaccccctgactctgtgtccaggggccccctctcctggacccatgtgcaccccaaggggcctaagtcattgctgagcctagagctgaaggacgatcgcccggccagagatatgtgggtaatggagacgggtctgttgttgccccgggccacagctcaagacgctggaaagtattattgtcaccgtggcaacctgaccatgtcattccacctggagatcactgctcggccagtactatggcactggctgctgaggactggtggctggaaggtctcagctgtgactttggcttatctgatcttctgcctgtgttcccttgtgggcattcttcatcttcaaagagccctggtcctgaggaggaaaagaaagcgaatgactgaccccaccaggagattcttcaaagtgacgcctcccccaggaagcgggccccagaaccagtacgggaacgtgctgtctctccccacacccacctcaggcctcggacgcgcccagcgttgggccgcaggcctggggggcactgccccgtcttatggaaacccgagcagcgacgtccaggcggatggagccttggggtcccggagcccgccgggagtgggcccagaagaagaggaaggggagggctatgaggaacctgacagtgaggaggactccgagttctatgagaacgactccaaccttgggcaggaccagctctcccaggatggcagcggctacgagaaccctgaggatgagcccctgggtcctgaggatgaagactccttctccaacgctgagtcttatgagaacgaggatgaagagctgacccagccggtcgccaggacaatggacttcctgagccctcatgggtcagcctgggaccccagccgggaagcaacctccctggggtcccagtcctatgaggatatgagaggaatcctgtatgcagccccccagctccgctccattcggggccagcctggacccaatcatgaggaagatgcagactcttatgagaacatggataatcccgatgggccagacccagcctggggaggagggggccgcatgggcacctggagcaccaggtga
Sequence Length
1671
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
930
Molecular Weight
61,200 Da
NCBI Official Full Name
Homo sapiens CD19 molecule, mRNA
NCBI Official Synonym Full Names
CD19 molecule
NCBI Official Symbol
CD19
NCBI Official Synonym Symbols
B4; CVID3
NCBI Protein Information
B-lymphocyte antigen CD19
UniProt Protein Name
B-lymphocyte antigen CD19
Protein Family
UniProt Gene Name
CD19
UniProt Entry Name
CD19_HUMAN

NCBI Description

Lymphocytes proliferate and differentiate in response to various concentrations of different antigens. The ability of the B cell to respond in a specific, yet sensitive manner to the various antigens is achieved with the use of low-affinity antigen receptors. This gene encodes a cell surface molecule which assembles with the antigen receptor of B lymphocytes in order to decrease the threshold for antigen receptor-dependent stimulation. [provided by RefSeq, Jul 2008]

Uniprot Description

CD19: a cell surface molecule which assembles with the antigen receptor of B lymphocytes. A critical signal transduction molecule that regulates B lymphocyte development, activation, and differentiation. Ligation increases intracellular calcium levels and decreases the threshold for antigen receptor signaling. Germinal center formation is significantly reduced in CD19-deficient mice.

Protein type: Membrane protein, integral; Cell surface

Chromosomal Location of Human Ortholog: 16p11.2

Cellular Component: external side of plasma membrane; integral to plasma membrane; plasma membrane; protein complex

Molecular Function: phosphatidylinositol-4,5-bisphosphate 3-kinase activity; protein binding; receptor signaling protein activity

Biological Process: B cell receptor signaling pathway; cell surface receptor linked signal transduction; cellular defense response; phosphoinositide-mediated signaling; regulation of immune response; regulation of phosphoinositide 3-kinase cascade

Disease: Immunodeficiency, Common Variable, 2; Immunodeficiency, Common Variable, 3

Research Articles on CD19

Similar Products

Product Notes

The CD19 cd19 (Catalog #AAA1274755) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccacctc ctcgcctcct cttcttcctc ctcttcctca cccccatgga agtcaggccc gaggaacctc tagtggtgaa ggtggaagag ggagataacg ctgtgctgca gtgcctcaag gggacctcag atggccccac tcagcagctg acctggtctc gggagtcccc gcttaaaccc ttcttaaaac tcagcctggg gctgccaggc ctgggaatcc acatgaggcc cctggccatc tggcttttca tcttcaacgt ctctcaacag atggggggct tctacctgtg ccagccgggg cccccctctg agaaggcctg gcagcctggc tggacagtca atgtggaggg cagcggggag ctgttccggt ggaatgtttc ggacctaggt ggcctgggct gtggcctgaa gaacaggtcc tcagagggcc ccagctcccc ttccgggaag ctcatgagcc ccaagctgta tgtgtgggcc aaagaccgcc ctgagatctg ggagggagag cctccgtgtc tcccaccgag ggacagcctg aaccagagcc tcagccagga cctcaccatg gcccctggct ccacactctg gctgtcctgt ggggtacccc ctgactctgt gtccaggggc cccctctcct ggacccatgt gcaccccaag gggcctaagt cattgctgag cctagagctg aaggacgatc gcccggccag agatatgtgg gtaatggaga cgggtctgtt gttgccccgg gccacagctc aagacgctgg aaagtattat tgtcaccgtg gcaacctgac catgtcattc cacctggaga tcactgctcg gccagtacta tggcactggc tgctgaggac tggtggctgg aaggtctcag ctgtgacttt ggcttatctg atcttctgcc tgtgttccct tgtgggcatt cttcatcttc aaagagccct ggtcctgagg aggaaaagaa agcgaatgac tgaccccacc aggagattct tcaaagtgac gcctccccca ggaagcgggc cccagaacca gtacgggaac gtgctgtctc tccccacacc cacctcaggc ctcggacgcg cccagcgttg ggccgcaggc ctggggggca ctgccccgtc ttatggaaac ccgagcagcg acgtccaggc ggatggagcc ttggggtccc ggagcccgcc gggagtgggc ccagaagaag aggaagggga gggctatgag gaacctgaca gtgaggagga ctccgagttc tatgagaacg actccaacct tgggcaggac cagctctccc aggatggcag cggctacgag aaccctgagg atgagcccct gggtcctgag gatgaagact ccttctccaa cgctgagtct tatgagaacg aggatgaaga gctgacccag ccggtcgcca ggacaatgga cttcctgagc cctcatgggt cagcctggga ccccagccgg gaagcaacct ccctggggtc ccagtcctat gaggatatga gaggaatcct gtatgcagcc ccccagctcc gctccattcg gggccagcct ggacccaatc atgaggaaga tgcagactct tatgagaaca tggataatcc cgatgggcca gacccagcct ggggaggagg gggccgcatg ggcacctgga gcaccaggtg a. It is sometimes possible for the material contained within the vial of "CD19, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.