CCT7 cdna clone
CCT7 cDNA Clone
Gene Names
CCT7; CCTH; CCTETA; NIP7-1; TCP1ETA
Synonyms
CCT7; CCT7 cDNA Clone; CCT7 cdna clone
Sequence
atgatgcccacaccagttatcctattgaaagaggggactgatagctcccaaggcatcccccagcttgtgagtaacatcagtgcctgccaggtgattgctgaggctgtaagaactaccctgggtccccgtggcatggacaagcttattgtagatggcagaggcaaagcaacaatttctaatgatggggccacaattctgaaacttcttgatgttgtccatcctgcagcaaagactttggtagacattgccaaatcccaagatgctgaggtgggtgatggcaccacctcagtgaccttgctggctgcagagtttctgaagcaggtgaaaccctatgtggaggaaggtttacacccccagatcatcattcgagctttccgcacagccacccagctggcagttaacaagatcaaagagattgctgtgaccgtgaagaaggcagataaagtggagcagaggaagctgctggaaaagtgtgccatgaccgctctgagctccaagctgatctcccagcagaaagctttctttgctaagatggtggtggatgcagtgatgatgctcgatgatttgctgcagcttaaaatgattggaatcaagaaggtacagggtggagccctcgaggattctcagctggtagctggtgttgcattcaagaagactttctcttacgctgggtttgaaatgcaacccaaaaagtaccacaatcccaagattgcccttttgaatgtcgagctcgagttgaaagctgagaaagacaatgctgagataagagtccacacagttgaggattatcaggcaattgttgatgctgagtggaacattctctatgacaagttagagaagatccatcattctggagccaaagttgtcttgtccaaactccccattggggatgtggccacccagtactttgctgacagggacatgttctgtgctggccgagtacctgaggaggatctgaagaggacaatgatggcctgtggaggctcaatccagaccagtgtgaatgctctgtcagcagatgtgctgggtcgatgccaggtgtttgaagagacccagattggaggcgagaggtacaatttttttactggctgccccaaggccaagacatgcaccttcattctccgtggcggcgccgagcagtttatggaggagacagagcggtccctgcatgatgccatcatgatcgtcaggagggccatcaagaatgattcagtggtggctggtggcggggccattgagatggaactctccaagtacctgcgggattactcaaggactattccaggaaaacagcagctgttgattggggcttatgccaaggccttggagattatcccacgccagctgtgtgacaatgctggctttgatgccacaaacattctcaacaagctgcgggctcggcatgcccaggggggtacatggtatggagtagacatcaacaacgaggacattgctgacaactttgaagctttcgtgtgggagccagctatggtgcggatcaatgcgctgacagcagcctctgaggctgcgtgcctgatcgtgtctgtagatgaaaccatcaagaacccccgctcgactgtggatgctcccacagcagcaggccggggccgtggtcgtggccgcccccactga
Sequence Length
1632
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
50,352 Da
NCBI Official Full Name
Homo sapiens chaperonin containing TCP1, subunit 7 (eta), mRNA
NCBI Official Synonym Full Names
chaperonin containing TCP1 subunit 7
NCBI Official Symbol
CCT7
NCBI Official Synonym Symbols
CCTH; CCTETA; NIP7-1; TCP1ETA
NCBI Protein Information
T-complex protein 1 subunit eta
UniProt Protein Name
T-complex protein 1 subunit eta
Protein Family
UniProt Gene Name
CCT7
UniProt Synonym Gene Names
CCTH; NIP7-1; TCP-1-eta
UniProt Entry Name
TCPH_HUMAN
NCBI Description
This gene encodes a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 5 and 6. [provided by RefSeq, Oct 2009]
Uniprot Description
CCT7: Molecular chaperone; assists the folding of proteins upon ATP hydrolysis. Known to play a role, in vitro, in the folding of actin and tubulin. Belongs to the TCP-1 chaperonin family. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Chaperone
Chromosomal Location of Human Ortholog: 2p13.2
Cellular Component: chaperonin-containing T-complex; cytoplasm; cytosol; microtubule
Molecular Function: protein binding
Biological Process: positive regulation of telomere maintenance via telomerase; protein folding; protein stabilization
Research Articles on CCT7
Similar Products
Product Notes
The CCT7 cct7 (Catalog #AAA1276655) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgccca caccagttat cctattgaaa gaggggactg atagctccca aggcatcccc cagcttgtga gtaacatcag tgcctgccag gtgattgctg aggctgtaag aactaccctg ggtccccgtg gcatggacaa gcttattgta gatggcagag gcaaagcaac aatttctaat gatggggcca caattctgaa acttcttgat gttgtccatc ctgcagcaaa gactttggta gacattgcca aatcccaaga tgctgaggtg ggtgatggca ccacctcagt gaccttgctg gctgcagagt ttctgaagca ggtgaaaccc tatgtggagg aaggtttaca cccccagatc atcattcgag ctttccgcac agccacccag ctggcagtta acaagatcaa agagattgct gtgaccgtga agaaggcaga taaagtggag cagaggaagc tgctggaaaa gtgtgccatg accgctctga gctccaagct gatctcccag cagaaagctt tctttgctaa gatggtggtg gatgcagtga tgatgctcga tgatttgctg cagcttaaaa tgattggaat caagaaggta cagggtggag ccctcgagga ttctcagctg gtagctggtg ttgcattcaa gaagactttc tcttacgctg ggtttgaaat gcaacccaaa aagtaccaca atcccaagat tgcccttttg aatgtcgagc tcgagttgaa agctgagaaa gacaatgctg agataagagt ccacacagtt gaggattatc aggcaattgt tgatgctgag tggaacattc tctatgacaa gttagagaag atccatcatt ctggagccaa agttgtcttg tccaaactcc ccattgggga tgtggccacc cagtactttg ctgacaggga catgttctgt gctggccgag tacctgagga ggatctgaag aggacaatga tggcctgtgg aggctcaatc cagaccagtg tgaatgctct gtcagcagat gtgctgggtc gatgccaggt gtttgaagag acccagattg gaggcgagag gtacaatttt tttactggct gccccaaggc caagacatgc accttcattc tccgtggcgg cgccgagcag tttatggagg agacagagcg gtccctgcat gatgccatca tgatcgtcag gagggccatc aagaatgatt cagtggtggc tggtggcggg gccattgaga tggaactctc caagtacctg cgggattact caaggactat tccaggaaaa cagcagctgt tgattggggc ttatgccaag gccttggaga ttatcccacg ccagctgtgt gacaatgctg gctttgatgc cacaaacatt ctcaacaagc tgcgggctcg gcatgcccag gggggtacat ggtatggagt agacatcaac aacgaggaca ttgctgacaa ctttgaagct ttcgtgtggg agccagctat ggtgcggatc aatgcgctga cagcagcctc tgaggctgcg tgcctgatcg tgtctgtaga tgaaaccatc aagaaccccc gctcgactgt ggatgctccc acagcagcag gccggggccg tggtcgtggc cgcccccact ga. It is sometimes possible for the material contained within the vial of "CCT7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
